Summary Sequence Context  
1 homologue found:

HomologuedndE
OrganismPseudoalteromonas haloplanktis TAC125
GID1067
PID2067
Locus tagPSHAb0095
Locations112702..113073
Length372 bp
G+C%41
Link NCBI: gi:77361923  
SequenceATGAATACCACACTCCAAACAATTGACTCAATTAAGCTCTCTGAAAAACAAAAGCAGCAACTCGTTCGCC
TTAAAAGTAAAACAGGCATCGAAAATTGGAACGTACTGTGCCGCTGGGCTCTGTGTATGTCGCTCGCTGA
AGATTCAATACCACCTGTTGAGGAAATCCCATCAGACAGTAACGTAGAAATGAGCTGGAAGGTATTTGCT
GGTGAATATGCCGATGTATATTTAGCAGTGCTGCGTGAAGCGTATCAAAAACAAAGTGCACACCTAGAAG
GTGTGCATTTTGGAGATTTTCTTAAGCTGCACTTGAATCGAGGGATTAGTTTCTCACTAAGTTTTCCCAG
TTATAAATGTAAAGGATTATAA