Summary Sequence Alignment 16S rRNA Context  
4 homologues found:

HomologuedndB
OrganismEscherichia coli B7A
GID1014
PID2014
Locus tagEcolB7_01003586
Locations26232..27329
Length1098 bp
G+C%48
Link NCBI: gi:75228072  
SequenceATGGATTACAGCATGGCTAGTGTTGATGCAGATTACTGCTACTCGTTTCCGGCTATACGTGGCATTCAGG
CTGGTCGCCCTTTCTATATCGCCACATGCCCGATGCGTATCATCCCGAAAATATTCAGTTTTGATGAAAA
TGATGTGCCACCGGAATTACGCGCACAGCGCACGCTAAATAAATCGCGCATTCCCGAGATGGTACGTTAT
TTGTTGGAAAACCCTAAAGATTATGTGTTTTCAGCTCTGACGGCTTCCATTGCCGTAGACGTTCAATTTG
ATGAGTTTCCAGGTTCTAACAATCTGGGGACGTTGTGCGTACCAATGGATGCGCAAATTCTAATCAATGA
TGGACAACATCGCCGTAAAGCGATTGAAGACGCTTTAGACGCTCGTCCGGAGCTGGGCCAGGATAATATC
CCGGTGTTGTTCTTTGTCGATGAAGGCTTAAAGCGTAGCCAGCAGATGTTCGCCGATCTGAATAAATACG
CCATTCGCCCCAGCCCATCGCTGGCGTCGCTATACGATCATCGCGATGCCTGTTCGAATCTGGCGCGTTA
TCTGGCAATGTCAGTAGAGCCGTTTGTTGGGATGACGGAACTGGAAAAATCTGGCATTAGCCAGAGGTCG
AATAAGCTATTTACGTTGAGCAGCATCAAGCAGGCTACCCGCGCATTGTTGGGCAAAGATCCCAAAGAGG
ATAACTTTGAGGAATGCACCCACATTGCTACCCAATATTGGCAGGCTATTTTTAGTGTAATGCCTGATTG
GCAATTAGCGGCTAAAAAGGAAGTTTCACCGGTTCAATTGCGACAAGATTATGTTCACGCTCATGGCATT
GGATTGCAGGCACTTGGGCAACTAGGATATACCCTGCTGACGGATTATCCTGAGCAATGGCCGGAGAAAA
TCGCTGCACTCAAAACATTTAACTGGCGTAGAAACAATCCGGACCTCATCAAGCGAGCGATGCAGCATGG
GAAGTTGAGTAAAACCAGTACCGCGATCCAGTTAACCTGCAATGCGCTAAAAACCGCACTCTCAATTCCC
CTCACTCCTGAAGAACAGGAGCTTGAAGCTCAAATGGTTGTCTCATGA

HomologuedndC
OrganismEscherichia coli B7A
GID1032
PID2032
Locus tagEcolB7_01003585
Locations24613..26235
Length1623 bp
G+C%49
Link NCBI: gi:75228072  
SequenceATGAGTAAATTAGTTCAGGCCTATGATTTGGCCGAATACGAAGATTTTATTAATCAGGAACAGTTCGCCG
GACGTCCTCTGGCCGAATATGTTGCTGAGGTTCAACGAATTTATTGTGCGGATAAACGTCCGTGGGTGAT
TGGCTACAGCGGTGGGAAAGATTCTTCCGCTGTGATCACGCTGGTGTATCTGGCCTTGCTCGGCCTGCCC
CCGGAAATGCGCAGCAAAGATATTTTTGTGGTGTCGTCCGATACGCTGGTCGAAACACCGGTAGTCGTGG
ATCTGATTAAGAAAACGATGTTGCAGATTGAGGCGGGAGCGAAGCGTAACGGCTTGCCGATCACTCAACA
CGCGGTAACGCCTAAAACGAATGAAACCTTCTGGGTCAATTTGCTGGGGAAAGGTTATCCGGCTCCAACT
CGTAGTTTCCGTTGGTGCACTGAGCGCATGAAAATCAACCCGGTGAGTGACTTTATTAAAGATAAGGTCA
GCCAGTTTGATGAAGTCATCGTCGTACTTGGTTCGCGCAGTAGTGAAAGTGCTTCTCGTGCGCAGGTGAT
CGCAAAGCACAAGATTGATGGATCACGCCTTGCCCGGCATACCACGCTGGCAAATGCATTCATCTATACC
CCCATTGATACCTGGGATGTAGAAGATGTCTGGAAGCTGCTGCGGGGCGCGTTCCGCTATGCCCCTGAAG
ATATCGACGAGTGGGAAAGCCCGTGGGGTGGAAACAACCGTCCACTGTGGACGTTGTATATGGATTCTTC
CGCACAGGGTGAATGTCCTCTGGTAATTGATGATAGTACCCCTTCCTGCGGCAACTCGCGTTTTGGCTGT
TGGACCTGTACCGTTGTCACTAAAGATAAGGCGATGGAAAGCCTGATCAAAAACGGTGAAGAATGGATGT
CTCCGTTGCTGAAATATCGTGATCTGCTGGCATTTACCACCGATCCGGTGAATAAAGACACGTTTCGAAA
CTATAAGCGCCGTACTGGTAAGGTGAGCTATCAGTACGCTAAAGAAAGTGATGAGCCGGGGGCTGAGCGT
AAGCATGTTCCAGGTCCTTACTGGCTAAAATACCGTCAGCAATGGCTCAAAGAATTGCTGGAGATAGAGC
GCGATTTGAATGCTCAAGGCCATACCATTACGTTAATTACCAAACCAGAGCTGCATGCGATTCGTCAGGA
GTGGTTGAAAGATCCTAATGAACCAGACTGGTATGACACGCTGCCGGGTATTTACCGTGAAGTGTATCAA
CAGGATTTAGACTGGGTGGTGGACGATCAGTCGCGCTTTGATGCCAGCGATGCAGATCTGTTGGTGCAGA
TAGCGCAGGGATTTGACGTTGTGCCTGAAATGGTGATGAAACTCATCGAGCTGGAAGTTTCAATGGAAGG
CTTAAGCCGTCGTCAGGGCATTTTTGACAAACTTGGCACGATTTTAAAGCAGGACTGGGGCACTCTCGAA
GAAATTGAACAACAACAGGTCACTCTGCAAAAACGAGTTGAACGAGATATTCATCAGGAAGAACTTACAA
AGCTGGAAACTGAACTTCAGGTTTTACAGCGCAGAATTGTTGATGCCAGTGAATCCTCGTTACTGATTGG
GGAGGAGAAATAA

HomologuedndD
OrganismEscherichia coli B7A
GID1050
PID2050
Locus tagEcolB7_01003584
Locations22611..24611
Length2001 bp
G+C%44
Link NCBI: gi:75228072  
SequenceGTGCTCATTAAACAGCTGGTATTACATAATTTTCGGGTATTTAACGGTACACATACCATTGATCTGGCAC
CCAGAAAGCGTCCGCACGATTTGAATCCACGACCTATTGTGCTGTTTGGTGGTTTAAACGGCGCAGGGAA
AACGTCTATCCTGTCGGCGATCCGCATAGCGTTGTATGGACGACTGGCGTTTGGGCTAGCGACTCAACAG
CAAGAGTATATCGAACAACTCAGTGCATTGATTCATAACGGCGCGTACTATATTGAGCAGCCGGAAGAAG
CATCTGTAGAACTGACGTTTACCTATAATAAAGGCGGTCATGAGGCCGAATTTACCGTTACGCGAACCTG
GAAAAAGGGGAAGAGGGACCGCCTTTCTCTGCAACAGGATGGGCAGCCACTCAGTGAGCTGGATTACGAT
CAGTGCCAGGGATTTCTAAATGAGTTAATTCCGCATGGCATTGCTGATTTGTTCTTTTTCGATGGCGAGA
AAATTGCAGAACTTGCTGAGGACGAATCCGGTAATATTTTACGTACTGCCGTACGACGCTTATTGGGGCT
GGATCTCATCTCTAAACTGCGTAACGATTTAATGATTTTTGTTAAGCGTCAGCAATCCAGCCAGCTAGCA
AGTTCTCAGCAACAACAGATTGCAGAGCTTGAAAAACAGAGTAAAGAATTAGCCTGCCAGACAGAAGCAC
TGCTGGAAAGCGCCGATTTTGCCAAATCGCGGATTGAGTTTCTATCTAAAGATATAACCCATTATGAAGG
CTTGCTAAATGCTCAGGGGGGCGCTTTTGCCCAGACTAAAGCGCAGGAAAAACAGAAAGTCGAAACGCTG
CTAAAAGATAAAGAACATCTGGAAAAAGCACTGAGACAAGAATGCGATGGCTCGCTACCTTATGCGCTTG
CGCCCACTATTTTGTCTCATTTGCTGCAACAAATTGCTGATGAAACGCAAATTAAACAGGCAAAAAGCTT
TGAAAAAGAGCTGAGCCAGTTTTTAACGCAACTCAGAAATGATATTGCATTTCGTTCTGCGGGGACTGGC
AAAATAGCAGCTGAAGCGATTACCGATAATCTAAAAGATTATATGGCAACGAAACCAAAAGGTGATTTGC
TCTTTGATATCTCTGAGCGTGAAGCAGGTATGCTTCAACAGTCTATTGAGATAGATAGTAAAAGAGCATG
GCAGCGTTTCGAGCTTTATCGCACACAGTTATCTGAGATTGAACAACAGTTAGAACAAGCGGCTGCTAAT
ATTGCCCGCGCTCCTGAAGATGAGCAGCTGATGGATCTCTTTGAAAAATTACGTGACCTGGATAGGCAGC
GCGAAGCCCAATTGCAGAAATATCGGTCATTGCTAGAAGATGCTAAACGTAAAAAACAGCAGCAACTGGA
TTGTGTTCGTCAGATTCAAAAAGCGCATGACGCCGCTCGTTATCAGCACAGTTATAGCAGTGCGTTTAAG
AATGCTCAGGAAACGATAAATTTACTCGATCGCTACAGCGATGTATTAACCCAGGCTCGGGTAAAAACGC
TGTCGACAAACTTCGAGCTTGCTTACCGTAAGTTGGCTCGCAAAGAGGATTTACAACTTAGTGCGCATAT
CAACCCTCAAACGTTTGATGTTGAATTAATTGATGAGAATGGCTCAGTAATTAACCGTAAGTTACTTTCT
GCTGGTGAAAAACAGATTTATGCAATTGCTATTCTTGAGGCGCTGGCGAAAACCTCTGGCCGTGATTTAC
CAGTGATCATTGATACACCATTGGGTCGTCTGGACTCTCAACATCGAGATAAATTGATTAATCACTACTT
CCCTGAAGCCAGTCATCAGGTTGTGTTGCTTTCTACCGATACTGAAGTAGATGAACGTTATTTTGTTGAT
CAGTTGCGTGATGATATCTCTCATGCTTATGAGATTGTGTTTAATGCACATACTAAGTCATCAACGCTGA
AGCCTGGTTATTTCTGGGAATTAACTAAGGAGGCTATCTGA

HomologuedndE
OrganismEscherichia coli B7A
GID1084
PID2084
Locus tagEcolB7_01009999_dndD
Locations22258..22611
Length354 bp
G+C%44
Link NCBI: gi:75228072   
SequenceATGCTCCCGAATCGAATGGCGCTTAGCCGTCAGACTGAAGATCAGCTTAAAAAGCTTAAAGGGTATACTG
GGATTACACCCAATATTGCTGCCCGGCTAGCATTTTTCCGCTCGGTGGAGAGTGAGTTTCGCTATTCACC
TGAACGAGATAGTAAGAAGCTGGATGGTACGCTGGTGCTGGATAAAATTACGTGGCTGGGGGAGACACTA
CAAGCTACAGAATTGGTGCTGAAGATGCTTTATCCACAATTAGAGCAAAAGGCGTTGATTAAGGCATGGG
CTGCTCATGTTGAGGATGGGATTGCGGCATTGAGAAATCATAAAAGTTTAATTAGCTTATTAAATGCTAT
ATAA