Summary Sequence Context  
1 homologue found:

HomologuedndB
OrganismEscherichia coli B7A
GID1014
PID2014
Locus tagEcolB7_01003586
Locations26232..27329
Length1098 bp
G+C%48
Link NCBI: gi:75228072  
SequenceATGGATTACAGCATGGCTAGTGTTGATGCAGATTACTGCTACTCGTTTCCGGCTATACGTGGCATTCAGG
CTGGTCGCCCTTTCTATATCGCCACATGCCCGATGCGTATCATCCCGAAAATATTCAGTTTTGATGAAAA
TGATGTGCCACCGGAATTACGCGCACAGCGCACGCTAAATAAATCGCGCATTCCCGAGATGGTACGTTAT
TTGTTGGAAAACCCTAAAGATTATGTGTTTTCAGCTCTGACGGCTTCCATTGCCGTAGACGTTCAATTTG
ATGAGTTTCCAGGTTCTAACAATCTGGGGACGTTGTGCGTACCAATGGATGCGCAAATTCTAATCAATGA
TGGACAACATCGCCGTAAAGCGATTGAAGACGCTTTAGACGCTCGTCCGGAGCTGGGCCAGGATAATATC
CCGGTGTTGTTCTTTGTCGATGAAGGCTTAAAGCGTAGCCAGCAGATGTTCGCCGATCTGAATAAATACG
CCATTCGCCCCAGCCCATCGCTGGCGTCGCTATACGATCATCGCGATGCCTGTTCGAATCTGGCGCGTTA
TCTGGCAATGTCAGTAGAGCCGTTTGTTGGGATGACGGAACTGGAAAAATCTGGCATTAGCCAGAGGTCG
AATAAGCTATTTACGTTGAGCAGCATCAAGCAGGCTACCCGCGCATTGTTGGGCAAAGATCCCAAAGAGG
ATAACTTTGAGGAATGCACCCACATTGCTACCCAATATTGGCAGGCTATTTTTAGTGTAATGCCTGATTG
GCAATTAGCGGCTAAAAAGGAAGTTTCACCGGTTCAATTGCGACAAGATTATGTTCACGCTCATGGCATT
GGATTGCAGGCACTTGGGCAACTAGGATATACCCTGCTGACGGATTATCCTGAGCAATGGCCGGAGAAAA
TCGCTGCACTCAAAACATTTAACTGGCGTAGAAACAATCCGGACCTCATCAAGCGAGCGATGCAGCATGG
GAAGTTGAGTAAAACCAGTACCGCGATCCAGTTAACCTGCAATGCGCTAAAAACCGCACTCTCAATTCCC
CTCACTCCTGAAGAACAGGAGCTTGAAGCTCAAATGGTTGTCTCATGA