Summary Sequence Context  
1 homologue found:

HomologuedndC
OrganismEscherichia coli B7A
GID1032
PID2032
Locus tagEcolB7_01003585
Locations24613..26235
Length1623 bp
G+C%49
Link NCBI: gi:75228072  
SequenceATGAGTAAATTAGTTCAGGCCTATGATTTGGCCGAATACGAAGATTTTATTAATCAGGAACAGTTCGCCG
GACGTCCTCTGGCCGAATATGTTGCTGAGGTTCAACGAATTTATTGTGCGGATAAACGTCCGTGGGTGAT
TGGCTACAGCGGTGGGAAAGATTCTTCCGCTGTGATCACGCTGGTGTATCTGGCCTTGCTCGGCCTGCCC
CCGGAAATGCGCAGCAAAGATATTTTTGTGGTGTCGTCCGATACGCTGGTCGAAACACCGGTAGTCGTGG
ATCTGATTAAGAAAACGATGTTGCAGATTGAGGCGGGAGCGAAGCGTAACGGCTTGCCGATCACTCAACA
CGCGGTAACGCCTAAAACGAATGAAACCTTCTGGGTCAATTTGCTGGGGAAAGGTTATCCGGCTCCAACT
CGTAGTTTCCGTTGGTGCACTGAGCGCATGAAAATCAACCCGGTGAGTGACTTTATTAAAGATAAGGTCA
GCCAGTTTGATGAAGTCATCGTCGTACTTGGTTCGCGCAGTAGTGAAAGTGCTTCTCGTGCGCAGGTGAT
CGCAAAGCACAAGATTGATGGATCACGCCTTGCCCGGCATACCACGCTGGCAAATGCATTCATCTATACC
CCCATTGATACCTGGGATGTAGAAGATGTCTGGAAGCTGCTGCGGGGCGCGTTCCGCTATGCCCCTGAAG
ATATCGACGAGTGGGAAAGCCCGTGGGGTGGAAACAACCGTCCACTGTGGACGTTGTATATGGATTCTTC
CGCACAGGGTGAATGTCCTCTGGTAATTGATGATAGTACCCCTTCCTGCGGCAACTCGCGTTTTGGCTGT
TGGACCTGTACCGTTGTCACTAAAGATAAGGCGATGGAAAGCCTGATCAAAAACGGTGAAGAATGGATGT
CTCCGTTGCTGAAATATCGTGATCTGCTGGCATTTACCACCGATCCGGTGAATAAAGACACGTTTCGAAA
CTATAAGCGCCGTACTGGTAAGGTGAGCTATCAGTACGCTAAAGAAAGTGATGAGCCGGGGGCTGAGCGT
AAGCATGTTCCAGGTCCTTACTGGCTAAAATACCGTCAGCAATGGCTCAAAGAATTGCTGGAGATAGAGC
GCGATTTGAATGCTCAAGGCCATACCATTACGTTAATTACCAAACCAGAGCTGCATGCGATTCGTCAGGA
GTGGTTGAAAGATCCTAATGAACCAGACTGGTATGACACGCTGCCGGGTATTTACCGTGAAGTGTATCAA
CAGGATTTAGACTGGGTGGTGGACGATCAGTCGCGCTTTGATGCCAGCGATGCAGATCTGTTGGTGCAGA
TAGCGCAGGGATTTGACGTTGTGCCTGAAATGGTGATGAAACTCATCGAGCTGGAAGTTTCAATGGAAGG
CTTAAGCCGTCGTCAGGGCATTTTTGACAAACTTGGCACGATTTTAAAGCAGGACTGGGGCACTCTCGAA
GAAATTGAACAACAACAGGTCACTCTGCAAAAACGAGTTGAACGAGATATTCATCAGGAAGAACTTACAA
AGCTGGAAACTGAACTTCAGGTTTTACAGCGCAGAATTGTTGATGCCAGTGAATCCTCGTTACTGATTGG
GGAGGAGAAATAA