Summary Sequence Context  
1 homologue found:

HomologuedndD
OrganismEscherichia coli B7A
GID1050
PID2050
Locus tagEcolB7_01003584
Locations22611..24611
Length2001 bp
G+C%44
Link NCBI: gi:75228072  
SequenceGTGCTCATTAAACAGCTGGTATTACATAATTTTCGGGTATTTAACGGTACACATACCATTGATCTGGCAC
CCAGAAAGCGTCCGCACGATTTGAATCCACGACCTATTGTGCTGTTTGGTGGTTTAAACGGCGCAGGGAA
AACGTCTATCCTGTCGGCGATCCGCATAGCGTTGTATGGACGACTGGCGTTTGGGCTAGCGACTCAACAG
CAAGAGTATATCGAACAACTCAGTGCATTGATTCATAACGGCGCGTACTATATTGAGCAGCCGGAAGAAG
CATCTGTAGAACTGACGTTTACCTATAATAAAGGCGGTCATGAGGCCGAATTTACCGTTACGCGAACCTG
GAAAAAGGGGAAGAGGGACCGCCTTTCTCTGCAACAGGATGGGCAGCCACTCAGTGAGCTGGATTACGAT
CAGTGCCAGGGATTTCTAAATGAGTTAATTCCGCATGGCATTGCTGATTTGTTCTTTTTCGATGGCGAGA
AAATTGCAGAACTTGCTGAGGACGAATCCGGTAATATTTTACGTACTGCCGTACGACGCTTATTGGGGCT
GGATCTCATCTCTAAACTGCGTAACGATTTAATGATTTTTGTTAAGCGTCAGCAATCCAGCCAGCTAGCA
AGTTCTCAGCAACAACAGATTGCAGAGCTTGAAAAACAGAGTAAAGAATTAGCCTGCCAGACAGAAGCAC
TGCTGGAAAGCGCCGATTTTGCCAAATCGCGGATTGAGTTTCTATCTAAAGATATAACCCATTATGAAGG
CTTGCTAAATGCTCAGGGGGGCGCTTTTGCCCAGACTAAAGCGCAGGAAAAACAGAAAGTCGAAACGCTG
CTAAAAGATAAAGAACATCTGGAAAAAGCACTGAGACAAGAATGCGATGGCTCGCTACCTTATGCGCTTG
CGCCCACTATTTTGTCTCATTTGCTGCAACAAATTGCTGATGAAACGCAAATTAAACAGGCAAAAAGCTT
TGAAAAAGAGCTGAGCCAGTTTTTAACGCAACTCAGAAATGATATTGCATTTCGTTCTGCGGGGACTGGC
AAAATAGCAGCTGAAGCGATTACCGATAATCTAAAAGATTATATGGCAACGAAACCAAAAGGTGATTTGC
TCTTTGATATCTCTGAGCGTGAAGCAGGTATGCTTCAACAGTCTATTGAGATAGATAGTAAAAGAGCATG
GCAGCGTTTCGAGCTTTATCGCACACAGTTATCTGAGATTGAACAACAGTTAGAACAAGCGGCTGCTAAT
ATTGCCCGCGCTCCTGAAGATGAGCAGCTGATGGATCTCTTTGAAAAATTACGTGACCTGGATAGGCAGC
GCGAAGCCCAATTGCAGAAATATCGGTCATTGCTAGAAGATGCTAAACGTAAAAAACAGCAGCAACTGGA
TTGTGTTCGTCAGATTCAAAAAGCGCATGACGCCGCTCGTTATCAGCACAGTTATAGCAGTGCGTTTAAG
AATGCTCAGGAAACGATAAATTTACTCGATCGCTACAGCGATGTATTAACCCAGGCTCGGGTAAAAACGC
TGTCGACAAACTTCGAGCTTGCTTACCGTAAGTTGGCTCGCAAAGAGGATTTACAACTTAGTGCGCATAT
CAACCCTCAAACGTTTGATGTTGAATTAATTGATGAGAATGGCTCAGTAATTAACCGTAAGTTACTTTCT
GCTGGTGAAAAACAGATTTATGCAATTGCTATTCTTGAGGCGCTGGCGAAAACCTCTGGCCGTGATTTAC
CAGTGATCATTGATACACCATTGGGTCGTCTGGACTCTCAACATCGAGATAAATTGATTAATCACTACTT
CCCTGAAGCCAGTCATCAGGTTGTGTTGCTTTCTACCGATACTGAAGTAGATGAACGTTATTTTGTTGAT
CAGTTGCGTGATGATATCTCTCATGCTTATGAGATTGTGTTTAATGCACATACTAAGTCATCAACGCTGA
AGCCTGGTTATTTCTGGGAATTAACTAAGGAGGCTATCTGA