Summary Sequence Context  
1 homologue found:

HomologuedndE
OrganismEscherichia coli B7A
GID1084
PID2084
Locus tagEcolB7_01009999_dndD
Locations22258..22611
Length354 bp
G+C%44
Link NCBI: gi:75228072   
SequenceATGCTCCCGAATCGAATGGCGCTTAGCCGTCAGACTGAAGATCAGCTTAAAAAGCTTAAAGGGTATACTG
GGATTACACCCAATATTGCTGCCCGGCTAGCATTTTTCCGCTCGGTGGAGAGTGAGTTTCGCTATTCACC
TGAACGAGATAGTAAGAAGCTGGATGGTACGCTGGTGCTGGATAAAATTACGTGGCTGGGGGAGACACTA
CAAGCTACAGAATTGGTGCTGAAGATGCTTTATCCACAATTAGAGCAAAAGGCGTTGATTAAGGCATGGG
CTGCTCATGTTGAGGATGGGATTGCGGCATTGAGAAATCATAAAAGTTTAATTAGCTTATTAAATGCTAT
ATAA