Summary Sequence Alignment 16S rRNA Context  
4 homologues found:

HomologuedndB
OrganismHahella chejuensis KCTC 2396
GID1015
PID2015
Locus tagHCH_07042
Locations7161628..7162728
Length1101 bp
G+C%49
Link NCBI: gi:83642913  
SequenceATGGTTTCATCTCTACTCAACGAATATACCCACAAATTCCCAGCGGTCCGAGGCATGCAAGCAGGCAGGC
CATGCTACATAGCGATGTGCCCGATGAGGCTTATACCCAAATTATTTGTCTTCGACGAAGATGTTGTACC
CCCGGAGCTTCGCGCCCAACGTCGCCTAAACGAAAGCCGTGTACCCGATATTACTCATTATCTCGTCGAA
AATCCTGATTCATATACGCTCTCTGCGATCACGGCATCTATCGACGGCTCCGTTATTTTCGAGCCTGTGG
CGGACACTGGGCCTGCAATTAACTTAGGCATGCTCTCCATTGGTATGGATACCCAGATTCTGGTGAATGA
TGGTCAGCACCGTCGTAAAGCCATCGAGCAAGCTGTAAAGGAAGCCCATGAGTTAGGGCACGATAATATT
CCTGTATTGTTCTTCGTTGATGAGGGCCTCACGCGAAGCCAGCAAATGTTTGCCGACCTTAATAAGCACG
CAGTGCGACCTTCAGATTCACTCAGTACGCTCTACGACCATAGAGATGGCGGCTCCAAACTAGCCAGATA
TGTATTTGAATGCGTGCCCTGCTTTAAGTCCCTAACCGATCTCGAAAGTAGTAGTCTCTCTAAGCGAAGC
AGCAAGCTCTTTACCTTGAGCTCTCTAAAACAGGCCTCAAAAGCTCTCCTAGGTAAACGCGGGAAAGATC
CAATATCAGAACCCGAAATGCAATTAGCCTGTGAGTACTGGGAAGCTGTCTGTAGTAACATGCCCCACTG
GCATGATGCCCTAGAACGCAATATCTCCACCTCCGATCTTCGAGAACAATACATCCATGCTCACGGGATT
GGATTGGGAGCACTGGGAGAAGCCGGATCTGACTTGCTGAGACAATTTCCGAATAATTGGAAAGATAAAC
TCACACACCTATCGGAGATCGACTGGAGTCGCTCAAATATTAAACAGTGGCGAGGCCGAGCCATGGACAA
TCACGGCAAGATCAGTAAGACACGCAGTAGCACCGTACTCACAGCAAATATCATCCGTCATGCACTTGGA
GTATCCCTGGGTGCAGAACAACAACACATCGAAGACCAGCTGACCTCATGA

HomologuedndC
OrganismHahella chejuensis KCTC 2396
GID1033
PID2033
Locus tagHCH_07043
Locations7162725..7164308
Length1584 bp
G+C%48
Link NCBI: gi:83642913  
SequenceATGAGCCAAAGAAAAACACTATACCCCAGCATGGATAAGATGCTGGAGGCGTCTGCATTCGCCGGCCGTC
CGGCGCTCGATCTGATTCTGGAAATACAGAGCCTCTACCTGGAGAATGACAAACCATGGGTTATCGGCTT
TAGTGGCGGCAAAGATAGTACAACAGTTTTATCTCTCATCTATGTAGCTCTTACTGGCCTCCCAGAAGCA
AAGCGCCACAAACATATCTATGTGATCTCATCAGACACCCTGGTCGAAACGCCTATGGTCGTCGATATGA
TCAACGATTCGATTGAGGCCATTAACAGAAATGCGCAGGACAAGAAGCTGCCTATTTCGGCCCACGTTGT
TTACCCCGCATGGAACGAAACCTTTTGGGTAAACCTCTTGGGTAAAGGCTACCCCGCACCGACTCAAAAC
TTCCGTTGGTGTACTGAGCGGATGAAAATCGATCCAGTCAGCACCTTTATCAAAGATAAAATTGCTCGCT
TTGGTGAAGTCATCGTTGTCTTAGGCGCTCGTAGTCAAGAAAGCTCTTCCCGCGCTCAGGTCATTGCAAA
ACATAAGATCGAAGGTTCTTCACTATCCCGTCACTCATCGTTACCTGGCGCCTTTACCTATATGCCAATT
GAGGACTGGACCTTCGATGAAGTTTGGATGTACCTCTTAGGTGCCCCTGCCCCCTGGGGTGGTGACCACT
TCGAACTGTTCGAGCTTTACAAAGACTCAAGTGCGGGTGAGTGCCCCTTGGTGATAGATACCAACACACC
CTCCTGTGGTAACTCCCGGTTTGGCTGCTGGACTTGCACGGTCGTCACAAAAGACAGAGCCATTGAAGGA
CTTATTGATTCAGGGGAAGTGTGGCTGAAGAAGCTTAAAAGCTTTCGCAACAAGCTCTTTAAAACTACGC
TTCCAGAAAATAAGAACGAGTACCGTAACTTTAAGCGTCGTACCGGACGAATTCAGTATGCACGCGGCGC
AATTGACAATGACAATATCGCCGAAATCAAAACGATTCCTGGGCCTTACCTGCTCGAATACAGAAAGCAA
TGGCTGAAAGAACTACTTACTATTGAGAAAAACCTCATAGAGGAAGGGCGAAAAATTCAGCTTATTCACC
CAGAAGAGCTTCATGCCATTCGAAAAGAGTGGATGTTCGATCCCAATGAGCCAGACTGGTCAGACGAACT
GCCCAAAATCTACCACAGTGTCTATGGCGAAGACTTAGACTGGGTCGAGCACGATAGTGGAGCCTTCTCA
CAGGCAGACGCCGACCTCATTGCCGAGCTTTCGGCCGAGAATGGTGTACCCGCAGAATTGGTCATGAAGC
TTTTAGAGCTTGAGCTCTCCATGGACGGCCTTAGTCGCCGCAAAGGGTTATTTAACAAGATTGAGAACTT
GCTCAAGAACGACTGGGGAAGCAAGGAAGATATTCAAGCGGCCAAAGCAGCAGCGACCCACACGTCAGAC
TTTAAAAACAAACTGAAAACTGAGCTCAACACCGAAAGCTCAGATCTACACCTGAAGTCTGTCTATGACG
AACAACTCAAAGCTCTGACAAAAGAGTATGAGGCCCTAAGCTAA

HomologuedndD
OrganismHahella chejuensis KCTC 2396
GID1051
PID2051
Locus tagHCH_07044
Locations7164308..7166299
Length1992 bp
G+C%47
Link NCBI: gi:83642913  
SequenceATGATTTTGAAAAGCCTCTACTTACAAAATTTTGGTGTTTTCCAAGGCAGTTTTGACGACAACCATGTCG
ACCTGGAACCACGAGTAAAGTACAACCGCAAGCGGCCGATCATTCTTTTCGGTGGCCTGAATGGTGCTGG
TAAAACAACAACGCTTACCGCTATAAGACTTGCACTCTATGGCAAGCAGAGTCTCGGACGTTCAGTGTCT
GTTCAGATCTACCACCAATTTTTAGTTGATGCCATCCATAAACCTAAGGGAAAGGTTCTCGCACCTAATA
CTGCCGGCATAAAGCTAGACTTCAACTTTGGGCGCCAGGGTGAGGTCATCGACTACACCGTCGAGCGCGT
CTGGACAGTGCGCGGCAAGAGCGTTTTTGAAAATGTCGAGATCTACCAGAACGACGAACACCTCAAAAGT
CTTACTGACCATCAAAAGCAGGCCTTCCTCAATGAGCTGATTCCAATTGGTGTGGCAGATCTGTTTTTCT
TCGATGGAGAGAAGATCGCCGACCTCGCCGAAGATAACAACAACAGTGCATTGGCTGATGCCATCAATCG
TCTTTTAGGCTTGGACATAATTGATCGGCTAAAGGCAGATCTTGGTGTTTACTTGCGTGATCGGAAACGA
GATAAGCTACCCTCTGCCATTCAAAAGGAGATGGAAGCCCTCGAGAACAGCTACAAATCTCTTTACTCCA
AATATCAGTCTCAACTAGCCGATATCGAAGCTCTAAGGATTGAATCGACCGAGCTCGAGACGACTAAAGA
ACGCTTGAACCAAATTATCAATGATCTGGGAGGTGCCTGGGCCAGCAATAGACAAGAGGCCGAAACTAAA
GAAAAAATGCTGAGAGCCAAGCGGAATGAATTACAAGTGCAAATCAGGAATTTGATTGCAGATGCGGCTC
CTCTAGCATTGGCGACAAATCAAATAGCCGCTCTGCTAAAGCAGCTGACTGACGAACAACAGTCTAAACG
CCAACTGGTTCTCCAGGTTGAGCTACGTAAGCAGCTAAACAAAATTCAGAGCGCACTAATCAAGTCACTC
GGAAAAGAGCACAAAAAGGCCATTGAAACCTCTATTGAAGAAAGCTTACCCGCTGCGACCTCCATTGATA
CGAACATTATCCACGATATCTCTGATAGCGAATTCAACCGCCTGAATCACCTAATTACCAAAGTTGTGCC
AGAACAACAAGCCAAAGTGAAGGCGCTCTCTAGTGAACTTGAAGAAGTCGAAGAAGAACTAGCTCATGTT
GGCCTCAATATTTCACGCGCTCCAGATGAGCGTCGGATTTCTAACTTTGTTTCCGAACTGGGCGAAATCG
AAAACTCCCTTGGACAGCGCCAAGTTGAAATCAAACAAAGGACTGAAGCAGCCAAAGCCACTCTGCGCGA
GGCCATGGATAGCTTGCGCAAACTTCGAGAAAAAGAGAAGGAGTTCGGTAACGTAACAAATCTGGATCAA
GCGGTCACTTTAGCTGACCGTACTCGAGGACTATTGGAAAGCTTCTCCAGCAAAAGTCGCGAAACCAGGA
TCAATACCCTTGAGCAAGAGTTTATTAAATCTTTTGCCAAACTAGCCCGTAAAGACGATCTGATGATTAC
CGCTAAAATTGACCCCGAAACCTTCAGCGTCTCGCTAATCGACGGTACAGGTCATATCATCGATAAGAAG
AAACTATCCGCAGGTGAGAAGCAGATCTACGCTATTGCCATGCTGGAAGCCCTTGGACGGACCTCTGGTC
GCAACCTGCCAATCATTATTGATACGCCACTGGGCCGACTAGACTCCCACCACCGCGAGAATCTGGTTAA
AAACTACTTCCCAACCGCAAGTCATCAAGTATTAATCTTATCGACGGATACCGAAGTCGATGAAGACTTC
TATAAAGAACTGTCGCCAGAGATATCGCACGCTTTCGAGGTCGCTTACGACCCAGAAGCTGGAAGTTCCG
TATACTACGAAGGCTACTTCTGGCGTCACTGA

HomologuedndE
OrganismHahella chejuensis KCTC 2396
GID1068
PID2068
Locus tagHCH_07045
Locations7166351..7166686
Length336 bp
G+C%45
Link NCBI: gi:83642913  
SequenceATGCTGCCACAAAAAATGAAAATCTCAGAAAAGGCCTTTACCTCACTACGCCGGCTGCAGAATAACACAG
GTTTAACAGTGAATATCGGTGCTCGCCTGGCGTTCTTTGCTTCGATTGAACGTGGCTTCACATGGAATGG
CGATGACATCCAACTTACGCAACGTGAACTGGATAAGTATAGTTGGCTGGGTGACCACGGCGATATTATT
GAGATGCTACTGAAACAGAAATACCCAAACCTTGACAACAAAGACTACTACAAGGCTTGGGCCATCCATG
TGGATGATGGTGCAATAGTGATAGAGAACAAAAGCTCATTAGAGAGCTTGATGTAG