Summary Sequence Context  
1 homologue found:

HomologuedndB
OrganismHahella chejuensis KCTC 2396
GID1015
PID2015
Locus tagHCH_07042
Locations7161628..7162728
Length1101 bp
G+C%49
Link NCBI: gi:83642913  
SequenceATGGTTTCATCTCTACTCAACGAATATACCCACAAATTCCCAGCGGTCCGAGGCATGCAAGCAGGCAGGC
CATGCTACATAGCGATGTGCCCGATGAGGCTTATACCCAAATTATTTGTCTTCGACGAAGATGTTGTACC
CCCGGAGCTTCGCGCCCAACGTCGCCTAAACGAAAGCCGTGTACCCGATATTACTCATTATCTCGTCGAA
AATCCTGATTCATATACGCTCTCTGCGATCACGGCATCTATCGACGGCTCCGTTATTTTCGAGCCTGTGG
CGGACACTGGGCCTGCAATTAACTTAGGCATGCTCTCCATTGGTATGGATACCCAGATTCTGGTGAATGA
TGGTCAGCACCGTCGTAAAGCCATCGAGCAAGCTGTAAAGGAAGCCCATGAGTTAGGGCACGATAATATT
CCTGTATTGTTCTTCGTTGATGAGGGCCTCACGCGAAGCCAGCAAATGTTTGCCGACCTTAATAAGCACG
CAGTGCGACCTTCAGATTCACTCAGTACGCTCTACGACCATAGAGATGGCGGCTCCAAACTAGCCAGATA
TGTATTTGAATGCGTGCCCTGCTTTAAGTCCCTAACCGATCTCGAAAGTAGTAGTCTCTCTAAGCGAAGC
AGCAAGCTCTTTACCTTGAGCTCTCTAAAACAGGCCTCAAAAGCTCTCCTAGGTAAACGCGGGAAAGATC
CAATATCAGAACCCGAAATGCAATTAGCCTGTGAGTACTGGGAAGCTGTCTGTAGTAACATGCCCCACTG
GCATGATGCCCTAGAACGCAATATCTCCACCTCCGATCTTCGAGAACAATACATCCATGCTCACGGGATT
GGATTGGGAGCACTGGGAGAAGCCGGATCTGACTTGCTGAGACAATTTCCGAATAATTGGAAAGATAAAC
TCACACACCTATCGGAGATCGACTGGAGTCGCTCAAATATTAAACAGTGGCGAGGCCGAGCCATGGACAA
TCACGGCAAGATCAGTAAGACACGCAGTAGCACCGTACTCACAGCAAATATCATCCGTCATGCACTTGGA
GTATCCCTGGGTGCAGAACAACAACACATCGAAGACCAGCTGACCTCATGA