Summary Sequence Context  
1 homologue found:

HomologuedndC
OrganismHahella chejuensis KCTC 2396
GID1033
PID2033
Locus tagHCH_07043
Locations7162725..7164308
Length1584 bp
G+C%48
Link NCBI: gi:83642913  
SequenceATGAGCCAAAGAAAAACACTATACCCCAGCATGGATAAGATGCTGGAGGCGTCTGCATTCGCCGGCCGTC
CGGCGCTCGATCTGATTCTGGAAATACAGAGCCTCTACCTGGAGAATGACAAACCATGGGTTATCGGCTT
TAGTGGCGGCAAAGATAGTACAACAGTTTTATCTCTCATCTATGTAGCTCTTACTGGCCTCCCAGAAGCA
AAGCGCCACAAACATATCTATGTGATCTCATCAGACACCCTGGTCGAAACGCCTATGGTCGTCGATATGA
TCAACGATTCGATTGAGGCCATTAACAGAAATGCGCAGGACAAGAAGCTGCCTATTTCGGCCCACGTTGT
TTACCCCGCATGGAACGAAACCTTTTGGGTAAACCTCTTGGGTAAAGGCTACCCCGCACCGACTCAAAAC
TTCCGTTGGTGTACTGAGCGGATGAAAATCGATCCAGTCAGCACCTTTATCAAAGATAAAATTGCTCGCT
TTGGTGAAGTCATCGTTGTCTTAGGCGCTCGTAGTCAAGAAAGCTCTTCCCGCGCTCAGGTCATTGCAAA
ACATAAGATCGAAGGTTCTTCACTATCCCGTCACTCATCGTTACCTGGCGCCTTTACCTATATGCCAATT
GAGGACTGGACCTTCGATGAAGTTTGGATGTACCTCTTAGGTGCCCCTGCCCCCTGGGGTGGTGACCACT
TCGAACTGTTCGAGCTTTACAAAGACTCAAGTGCGGGTGAGTGCCCCTTGGTGATAGATACCAACACACC
CTCCTGTGGTAACTCCCGGTTTGGCTGCTGGACTTGCACGGTCGTCACAAAAGACAGAGCCATTGAAGGA
CTTATTGATTCAGGGGAAGTGTGGCTGAAGAAGCTTAAAAGCTTTCGCAACAAGCTCTTTAAAACTACGC
TTCCAGAAAATAAGAACGAGTACCGTAACTTTAAGCGTCGTACCGGACGAATTCAGTATGCACGCGGCGC
AATTGACAATGACAATATCGCCGAAATCAAAACGATTCCTGGGCCTTACCTGCTCGAATACAGAAAGCAA
TGGCTGAAAGAACTACTTACTATTGAGAAAAACCTCATAGAGGAAGGGCGAAAAATTCAGCTTATTCACC
CAGAAGAGCTTCATGCCATTCGAAAAGAGTGGATGTTCGATCCCAATGAGCCAGACTGGTCAGACGAACT
GCCCAAAATCTACCACAGTGTCTATGGCGAAGACTTAGACTGGGTCGAGCACGATAGTGGAGCCTTCTCA
CAGGCAGACGCCGACCTCATTGCCGAGCTTTCGGCCGAGAATGGTGTACCCGCAGAATTGGTCATGAAGC
TTTTAGAGCTTGAGCTCTCCATGGACGGCCTTAGTCGCCGCAAAGGGTTATTTAACAAGATTGAGAACTT
GCTCAAGAACGACTGGGGAAGCAAGGAAGATATTCAAGCGGCCAAAGCAGCAGCGACCCACACGTCAGAC
TTTAAAAACAAACTGAAAACTGAGCTCAACACCGAAAGCTCAGATCTACACCTGAAGTCTGTCTATGACG
AACAACTCAAAGCTCTGACAAAAGAGTATGAGGCCCTAAGCTAA