Summary Sequence Context  
1 homologue found:

HomologuedndD
OrganismHahella chejuensis KCTC 2396
GID1051
PID2051
Locus tagHCH_07044
Locations7164308..7166299
Length1992 bp
G+C%47
Link NCBI: gi:83642913  
SequenceATGATTTTGAAAAGCCTCTACTTACAAAATTTTGGTGTTTTCCAAGGCAGTTTTGACGACAACCATGTCG
ACCTGGAACCACGAGTAAAGTACAACCGCAAGCGGCCGATCATTCTTTTCGGTGGCCTGAATGGTGCTGG
TAAAACAACAACGCTTACCGCTATAAGACTTGCACTCTATGGCAAGCAGAGTCTCGGACGTTCAGTGTCT
GTTCAGATCTACCACCAATTTTTAGTTGATGCCATCCATAAACCTAAGGGAAAGGTTCTCGCACCTAATA
CTGCCGGCATAAAGCTAGACTTCAACTTTGGGCGCCAGGGTGAGGTCATCGACTACACCGTCGAGCGCGT
CTGGACAGTGCGCGGCAAGAGCGTTTTTGAAAATGTCGAGATCTACCAGAACGACGAACACCTCAAAAGT
CTTACTGACCATCAAAAGCAGGCCTTCCTCAATGAGCTGATTCCAATTGGTGTGGCAGATCTGTTTTTCT
TCGATGGAGAGAAGATCGCCGACCTCGCCGAAGATAACAACAACAGTGCATTGGCTGATGCCATCAATCG
TCTTTTAGGCTTGGACATAATTGATCGGCTAAAGGCAGATCTTGGTGTTTACTTGCGTGATCGGAAACGA
GATAAGCTACCCTCTGCCATTCAAAAGGAGATGGAAGCCCTCGAGAACAGCTACAAATCTCTTTACTCCA
AATATCAGTCTCAACTAGCCGATATCGAAGCTCTAAGGATTGAATCGACCGAGCTCGAGACGACTAAAGA
ACGCTTGAACCAAATTATCAATGATCTGGGAGGTGCCTGGGCCAGCAATAGACAAGAGGCCGAAACTAAA
GAAAAAATGCTGAGAGCCAAGCGGAATGAATTACAAGTGCAAATCAGGAATTTGATTGCAGATGCGGCTC
CTCTAGCATTGGCGACAAATCAAATAGCCGCTCTGCTAAAGCAGCTGACTGACGAACAACAGTCTAAACG
CCAACTGGTTCTCCAGGTTGAGCTACGTAAGCAGCTAAACAAAATTCAGAGCGCACTAATCAAGTCACTC
GGAAAAGAGCACAAAAAGGCCATTGAAACCTCTATTGAAGAAAGCTTACCCGCTGCGACCTCCATTGATA
CGAACATTATCCACGATATCTCTGATAGCGAATTCAACCGCCTGAATCACCTAATTACCAAAGTTGTGCC
AGAACAACAAGCCAAAGTGAAGGCGCTCTCTAGTGAACTTGAAGAAGTCGAAGAAGAACTAGCTCATGTT
GGCCTCAATATTTCACGCGCTCCAGATGAGCGTCGGATTTCTAACTTTGTTTCCGAACTGGGCGAAATCG
AAAACTCCCTTGGACAGCGCCAAGTTGAAATCAAACAAAGGACTGAAGCAGCCAAAGCCACTCTGCGCGA
GGCCATGGATAGCTTGCGCAAACTTCGAGAAAAAGAGAAGGAGTTCGGTAACGTAACAAATCTGGATCAA
GCGGTCACTTTAGCTGACCGTACTCGAGGACTATTGGAAAGCTTCTCCAGCAAAAGTCGCGAAACCAGGA
TCAATACCCTTGAGCAAGAGTTTATTAAATCTTTTGCCAAACTAGCCCGTAAAGACGATCTGATGATTAC
CGCTAAAATTGACCCCGAAACCTTCAGCGTCTCGCTAATCGACGGTACAGGTCATATCATCGATAAGAAG
AAACTATCCGCAGGTGAGAAGCAGATCTACGCTATTGCCATGCTGGAAGCCCTTGGACGGACCTCTGGTC
GCAACCTGCCAATCATTATTGATACGCCACTGGGCCGACTAGACTCCCACCACCGCGAGAATCTGGTTAA
AAACTACTTCCCAACCGCAAGTCATCAAGTATTAATCTTATCGACGGATACCGAAGTCGATGAAGACTTC
TATAAAGAACTGTCGCCAGAGATATCGCACGCTTTCGAGGTCGCTTACGACCCAGAAGCTGGAAGTTCCG
TATACTACGAAGGCTACTTCTGGCGTCACTGA