Summary Sequence Context  
1 homologue found:

HomologuedndE
OrganismHahella chejuensis KCTC 2396
GID1068
PID2068
Locus tagHCH_07045
Locations7166351..7166686
Length336 bp
G+C%45
Link NCBI: gi:83642913  
SequenceATGCTGCCACAAAAAATGAAAATCTCAGAAAAGGCCTTTACCTCACTACGCCGGCTGCAGAATAACACAG
GTTTAACAGTGAATATCGGTGCTCGCCTGGCGTTCTTTGCTTCGATTGAACGTGGCTTCACATGGAATGG
CGATGACATCCAACTTACGCAACGTGAACTGGATAAGTATAGTTGGCTGGGTGACCACGGCGATATTATT
GAGATGCTACTGAAACAGAAATACCCAAACCTTGACAACAAAGACTACTACAAGGCTTGGGCCATCCATG
TGGATGATGGTGCAATAGTGATAGAGAACAAAAGCTCATTAGAGAGCTTGATGTAG