Summary Sequence Alignment 16S rRNA Context  
4 homologues found:

HomologuedndB
OrganismOceanobacter sp. RED65
GID1016
PID2016
Locus tagRED65_14677
Locations42166..43263
Length1098 bp
G+C%43
Link NCBI: gi:94499735  
SequenceATGGTCAAAACACTAATCAAAGAATACAGCCATTCTTTCCCCGCGGTTCGTGGCATGCAAGCAGGGAGAC
CATGCTATATTGCGATGTGTCCGATGCGAACTATCCCGAAAATCTTCGTATTTGATGAAGATGAAGTACC
TCCAGAATTGAGAGCTCAGCGCACACTAAACAAAACTAGAATTCCCGAAATTGCTGAGTATTTAATATCT
AATCCAAACGATTACACATTGTCTGCGATCACGGCATCAGTAAGTGAACAAGTTCACTTCGAGCCCATGG
CGGATACGGGTCCAGGAATTAACTTAGGTATGCTAACGGTTTCGATGGATGCTCAAATATTGATCAATGA
CGGCCAACACCGCAGAGCCGCAATTGAGGCTGCTATCCGAGAAGCGCATGAACTTGGTCATGACCATATT
CCGGTTTTATTCTTCGTAGACGAAGACCTCAAGCGAAGCCAACAAATGTTTGCTGATCTCAATAAATATG
CGGTAAGACCCAATGAATCAATCAGTACATTGTATGATCACCGAGATCCATTATCTGACCTCGCAAGGCA
CGTAGTAAAAAACGTTGATTGCTTTAAAAATCTTACAGAAATGGAAAAATCAAGCTTATCAAATCGTAGT
AGTAAGCTATTTACACTCAGTAGCATCAAGCTCGCGAGTAGAGCCCTGTTAAAAAAGGGCCCAAAGGAAA
GTGTGTCCGACAAGGAAAAGGAGTTGGCTACAGAGTTCTGGACAGAAGTTTGTGAAAATATTAAAGACTG
GCAAGATGCGAAGTCCAAAAAGGTTAGTACAGCAGATCTTCGACAGAATTATGTACATGCCCATGGTGTA
ACTTTACAAGCACTCGGCTCCGCTGGCGCTGACCTCTTAGCGCAAAAACCAAAAGCTTGGAGAAAGCACT
TAAACAAACTAGGGACAATAGACTGGTCTCGGTCTAACACGGGTATATGGGAAGGAAGAGCATTAATGTA
CGGCAAATTAAGTAAGGCCCGTGCCAATGTGATGCTTACTTCAAACCTGATCAAACAACATATGGGACTA
AATCTTAGCCCTGAAAGCCAAGAATACGAGAAACAGTTTAAATCATGA

HomologuedndC
OrganismOceanobacter sp. RED65
GID1034
PID2034
Locus tagRED65_14682
Locations43260..44798
Length1539 bp
G+C%43
Link NCBI: gi:94499735  
SequenceATGAGTCGCTCTACCCTATATGCAACAATGGATGAAATGATTTCAGCAACTGAAATTGCTGGTCGCCCAT
TGTCAGATTTAATAATTGAGATCCAAGATTTGTACTTGGATGACGATAAGCCTTGGGTCATTGGATTTAG
TGGTGGTAAAGATAGCACCACTATTTTGTCGCTTATATATATTGCAATCGAGAAATTGGAGCTTAAACAA
CGTCATAAACATATCTACGTGATTTCCTCAGACACACTGGTAGAAACACCAATGGTTGTAGATATGATCG
AGGATGTCGTTAATGCAATTAACGAAAAAGCGAAAACCAATAAGCTTCCAATGTCTGCTCACCAAGTTCA
CCCAAAGATGGATCAGACCTTCTGGACTAATCTATTGGGCAAAGGCTATCCAGCCCCCACACAGAACTTT
CGCTGGTGTACAGAAAGAATGAAAATTGACCCTGTTAGTGAATTCATTCTCGACAAAGTAACACGATTTG
GTGAAGTGGTTGTAGTCTTGGGTGCACGTAGTGATGAAAGTGCATCACGTGCGCAAGTAATAGCGAAACA
TAAAATAGATGGTTCATCATTATCACGCCACTCTTCACTACCAGGTGCTTTCACCTACATGCCAATTGAA
GATTGGTCTTTCGATGATGTATGGATGTACTTATTAGGCGCACCGGCGCCATGGGGTGGTGATCATTTCG
AACTATTTGATTTGTATAAGGATTCAAGTGCTGGCGAGTGTCCGTTGGTGATAGATACAAAAACACCTTC
TTGTGGTAACTCAAGGTTTGGCTGTTGGACTTGTACGGTTGTTACAAAAGATAGAGCGATGGAAGGATTA
ATTGATTCTGGTGAAACTTGGCTACAAGAGCTCAAAGACTTCCGAGACCAGTTGTTTCACTCGACGCTAC
CCGAGAACAAAGATAAGTATCGAAACTACAAGCGACGTACAGGTAAAGTGCAATACGCTCGAAAGAATTT
AGACAGTGAAGCAACAGAAGTGAAGACCATACCAGGACCATACTGGATGGAACGTCGCCAAATTTGGCTG
AAAGAGCTTCTAACGATTGAAAAGAAATTAAGGGATTCCGGGAAAGATATTACCTTGATTCATCCTGATG
AACTCTACGCTATTCGTCGAGAATGGATGTACGACCCTAACGAACCAGACTGGGCAGACACAGCACCAAA
GATATACCGTGAGGTATATGGCAAAGACTTAGACTGGGCTGACCAAGATGCCGGCAGTTTTTCCCAATCT
GACGCCGAGATACTCAGTTCTTTAGGGGCAGAGTTTGATGTTCCTTCAGAGCTTGTAATGAAACTCCTAG
ACCTAGAACAAGCAATGGATGGACTCAGTCGACGTAAAGGCTTGTATAAAAAAATAGATAGCCTCCTAAA
ACAAGATTGGGGAAGTTACGAGGACATTCGCGAAAAGATGGTGAACCATAAACACCAACACTCATTGGAC
AAGAATATTGATAAAGGCTACGACGAACGCTTAGGTGAACTGGCCGCGGAACTCGAGAGTCTGAACTAA

HomologuedndD
OrganismOceanobacter sp. RED65
GID1052
PID2052
Locus tagRED65_14687
Locations44798..46768
Length1971 bp
G+C%41
Link NCBI: gi:94499735  
SequenceATGATTTTAAATACATTAACCTTACAAGACTTTGGCGTGTTTAATGGTTATCACGAAATTAATCTTGAGC
CCAAAGAGAAATACAATAGAAAGCGTCCTATCATCTTATTTGGTGGATTAAATGGTGCAGGCAAAACCAC
AACACTTACCGCTGTACGACTTGCCTTATATGGGAAGCAGAGTTTAGGGAAATCTGTATCGCAGGCAAAG
TACGAACAATACCTCGCTGACAGCATACACAAAGGCAAAGCACAGCTGGTACCTGCGACTAACGCTTCAG
TAGGCCTTAGCTTCACCTATGGAAAGCATGGCGTTGTGAATGAGTACAAAGTTATTCGTTCATGGGAAAT
TAAAGGTTCAACCACGAGCGAAAACCTCGTTGTAGAAAAAGACGGAGAACCACTCAGTGGGTCAACCAAT
GAGCAGCTACAGAGTTTCTTAAGCGAATTAATTCCAATTGGTGTCGCGGATCTTTTCTTTTTCGATGGGG
AAAAAATAGCCGAACTGGCAGAAGATAATGCTAATGAAGCGTTGGCTGATGCAATTAACCGTCTATTAGG
TCTCGATATCGTAGAGCGTCTGCGTGCGGACTTGGGTATTTATCTAAGAGAACATGCTCAACAAAAGCTA
CCAAAAGATATATCCGCTGAAATAAAAAGCCTTGAGAATCAATATCAAGACTCTTACAAAAGTTATCAGG
ATAAATTAGACCTTGTTAGTGAATTAAAGACAAAAGCAGGCTCGGTCGAAGCCGATATAGAAGCTCTCAA
CGCTCGTTTAAACGATTTGGGCGGCGCCTGGGCTAAAACAAAAGAGAAAGAAGAGCATAGAGTTGATCGC
CTAGTCGAAGAAAAGAATAGGCTTAAATCAGAACTTACAGCGCTATTTAGTGAAGCATTCCCACTATCAC
TCGCTCCCAACACTTTAAACAATCTAATTAAAAAGCTAGATGCAGAGAAACAAACCAAGTCAAATCAAGC
TTCAAGAGCTAAAATAGAACTGAAGGTTCAAGAGTTGAAAGCTCAACTTGGTGAACTAGATAATGCAGGA
AAAGTGATTGATGACACCTTTTCCGACGTTTTGGATACATCCGGCGACGTTGATGTTATTCACGATATTT
CTGATTCAGATTACATGAATATACAGCAGTTAGCTGTTCATAAACTCCCGGAGCAATTAAAGCGATTTAA
AAAGCTTACAAAGGACCTGGAGGAAATTGAGTCTGAAATATCGGCAGCGGCTGACAATATAGCTCGAGCG
CCTGATGAAAGTAGACTAAAAGATATCCTAGACGAATTAGGAATCCAACAAAAGGAATTGGGCAAAGTTG
ACGCAGAAATCCAGCAAGAAAAAGACAATGCAAAGGCGCGCCTAAGAGCAGCTATCGATACAATGCGAAA
GCTTAAAGACCTAGATGCTAAGTACTCCACCTCAATGAGTTCCATCCAAGGAGTAAAACTGGCTTCCGAT
TCACGCGAACTACTACTGGAATTTGGGCGAATAACGAAAGATAGGAAGATAGAATTACTTGAACAAGAAT
TTATAAAGTCTTTTGGCAAGCTTGCTCGTAAAGACGATATGGAAATCCTAGCCAAGATCGATCCAAAAAC
GTTCTCAGTAACACTCAAGGATAAACATGGAAAGGAAATCAACAAGAAAAAACTATCAGCAGGCGAAAAA
CAAATTTTCGCTATTGCCATGCTAGAGGCACTGGGTAGAACTTCAGGTAGAAATCTCCCTGTTATTATTG
ATACACCATTAGGTAGGCTGGATTCACACCATAGAACTAAACTGGTCAAAAATTACTTTCCGACAGCGAG
CCATCAGGTGCTGATTCTCTCTACGGACACGGAAATTGACGAGAGCTTCTATAAAGACCTTTCACCTGAG
ATATCACATGCCTTTTATGTGGATTATGACCCCAATGAAGGCTCCTCCAAATATACTGAAGGCTACTTCT
GGCGTAAATAA

HomologuedndE
OrganismOceanobacter sp. RED65
GID1069
PID2069
Locus tagRED65_14692
Locations46780..47118
Length339 bp
G+C%38
Link NCBI: gi:94499735  
SequenceATGTTACCAAATGAAATGAAAATCACTGATAATGCCTTTCATTCTCTTAGGCGCTTTCATTCAAATACTG
GAATAACGATCAATATAGGAGCTCGACTCGCTTTCTTTAAATCGATTGAAAGCGGGTACACTTATGATGG
GCGCGAAATGGAACCCCGCCAAAGATCCCTCAGTAAGCATGTTTGGCTAGGTGAACTAGAGCAAGTAGTT
GAGCTACTTCTGAAAGATAAGTATCCAGATATGCATCAAAAAGAATTATACAAGGCTTGGAATGCGCATG
TTGAAGATGGATCTGCAAGTATAGAAGGTAAAACAAATCTAAGTTCGTTTTTAGAATAG