Summary Sequence Context  
1 homologue found:

HomologuedndB
OrganismOceanobacter sp. RED65
GID1016
PID2016
Locus tagRED65_14677
Locations42166..43263
Length1098 bp
G+C%43
Link NCBI: gi:94499735  
SequenceATGGTCAAAACACTAATCAAAGAATACAGCCATTCTTTCCCCGCGGTTCGTGGCATGCAAGCAGGGAGAC
CATGCTATATTGCGATGTGTCCGATGCGAACTATCCCGAAAATCTTCGTATTTGATGAAGATGAAGTACC
TCCAGAATTGAGAGCTCAGCGCACACTAAACAAAACTAGAATTCCCGAAATTGCTGAGTATTTAATATCT
AATCCAAACGATTACACATTGTCTGCGATCACGGCATCAGTAAGTGAACAAGTTCACTTCGAGCCCATGG
CGGATACGGGTCCAGGAATTAACTTAGGTATGCTAACGGTTTCGATGGATGCTCAAATATTGATCAATGA
CGGCCAACACCGCAGAGCCGCAATTGAGGCTGCTATCCGAGAAGCGCATGAACTTGGTCATGACCATATT
CCGGTTTTATTCTTCGTAGACGAAGACCTCAAGCGAAGCCAACAAATGTTTGCTGATCTCAATAAATATG
CGGTAAGACCCAATGAATCAATCAGTACATTGTATGATCACCGAGATCCATTATCTGACCTCGCAAGGCA
CGTAGTAAAAAACGTTGATTGCTTTAAAAATCTTACAGAAATGGAAAAATCAAGCTTATCAAATCGTAGT
AGTAAGCTATTTACACTCAGTAGCATCAAGCTCGCGAGTAGAGCCCTGTTAAAAAAGGGCCCAAAGGAAA
GTGTGTCCGACAAGGAAAAGGAGTTGGCTACAGAGTTCTGGACAGAAGTTTGTGAAAATATTAAAGACTG
GCAAGATGCGAAGTCCAAAAAGGTTAGTACAGCAGATCTTCGACAGAATTATGTACATGCCCATGGTGTA
ACTTTACAAGCACTCGGCTCCGCTGGCGCTGACCTCTTAGCGCAAAAACCAAAAGCTTGGAGAAAGCACT
TAAACAAACTAGGGACAATAGACTGGTCTCGGTCTAACACGGGTATATGGGAAGGAAGAGCATTAATGTA
CGGCAAATTAAGTAAGGCCCGTGCCAATGTGATGCTTACTTCAAACCTGATCAAACAACATATGGGACTA
AATCTTAGCCCTGAAAGCCAAGAATACGAGAAACAGTTTAAATCATGA