Summary Sequence Context  
1 homologue found:

HomologuedndC
OrganismOceanobacter sp. RED65
GID1034
PID2034
Locus tagRED65_14682
Locations43260..44798
Length1539 bp
G+C%43
Link NCBI: gi:94499735  
SequenceATGAGTCGCTCTACCCTATATGCAACAATGGATGAAATGATTTCAGCAACTGAAATTGCTGGTCGCCCAT
TGTCAGATTTAATAATTGAGATCCAAGATTTGTACTTGGATGACGATAAGCCTTGGGTCATTGGATTTAG
TGGTGGTAAAGATAGCACCACTATTTTGTCGCTTATATATATTGCAATCGAGAAATTGGAGCTTAAACAA
CGTCATAAACATATCTACGTGATTTCCTCAGACACACTGGTAGAAACACCAATGGTTGTAGATATGATCG
AGGATGTCGTTAATGCAATTAACGAAAAAGCGAAAACCAATAAGCTTCCAATGTCTGCTCACCAAGTTCA
CCCAAAGATGGATCAGACCTTCTGGACTAATCTATTGGGCAAAGGCTATCCAGCCCCCACACAGAACTTT
CGCTGGTGTACAGAAAGAATGAAAATTGACCCTGTTAGTGAATTCATTCTCGACAAAGTAACACGATTTG
GTGAAGTGGTTGTAGTCTTGGGTGCACGTAGTGATGAAAGTGCATCACGTGCGCAAGTAATAGCGAAACA
TAAAATAGATGGTTCATCATTATCACGCCACTCTTCACTACCAGGTGCTTTCACCTACATGCCAATTGAA
GATTGGTCTTTCGATGATGTATGGATGTACTTATTAGGCGCACCGGCGCCATGGGGTGGTGATCATTTCG
AACTATTTGATTTGTATAAGGATTCAAGTGCTGGCGAGTGTCCGTTGGTGATAGATACAAAAACACCTTC
TTGTGGTAACTCAAGGTTTGGCTGTTGGACTTGTACGGTTGTTACAAAAGATAGAGCGATGGAAGGATTA
ATTGATTCTGGTGAAACTTGGCTACAAGAGCTCAAAGACTTCCGAGACCAGTTGTTTCACTCGACGCTAC
CCGAGAACAAAGATAAGTATCGAAACTACAAGCGACGTACAGGTAAAGTGCAATACGCTCGAAAGAATTT
AGACAGTGAAGCAACAGAAGTGAAGACCATACCAGGACCATACTGGATGGAACGTCGCCAAATTTGGCTG
AAAGAGCTTCTAACGATTGAAAAGAAATTAAGGGATTCCGGGAAAGATATTACCTTGATTCATCCTGATG
AACTCTACGCTATTCGTCGAGAATGGATGTACGACCCTAACGAACCAGACTGGGCAGACACAGCACCAAA
GATATACCGTGAGGTATATGGCAAAGACTTAGACTGGGCTGACCAAGATGCCGGCAGTTTTTCCCAATCT
GACGCCGAGATACTCAGTTCTTTAGGGGCAGAGTTTGATGTTCCTTCAGAGCTTGTAATGAAACTCCTAG
ACCTAGAACAAGCAATGGATGGACTCAGTCGACGTAAAGGCTTGTATAAAAAAATAGATAGCCTCCTAAA
ACAAGATTGGGGAAGTTACGAGGACATTCGCGAAAAGATGGTGAACCATAAACACCAACACTCATTGGAC
AAGAATATTGATAAAGGCTACGACGAACGCTTAGGTGAACTGGCCGCGGAACTCGAGAGTCTGAACTAA