Summary Sequence Context  
1 homologue found:

HomologuedndD
OrganismOceanobacter sp. RED65
GID1052
PID2052
Locus tagRED65_14687
Locations44798..46768
Length1971 bp
G+C%41
Link NCBI: gi:94499735  
SequenceATGATTTTAAATACATTAACCTTACAAGACTTTGGCGTGTTTAATGGTTATCACGAAATTAATCTTGAGC
CCAAAGAGAAATACAATAGAAAGCGTCCTATCATCTTATTTGGTGGATTAAATGGTGCAGGCAAAACCAC
AACACTTACCGCTGTACGACTTGCCTTATATGGGAAGCAGAGTTTAGGGAAATCTGTATCGCAGGCAAAG
TACGAACAATACCTCGCTGACAGCATACACAAAGGCAAAGCACAGCTGGTACCTGCGACTAACGCTTCAG
TAGGCCTTAGCTTCACCTATGGAAAGCATGGCGTTGTGAATGAGTACAAAGTTATTCGTTCATGGGAAAT
TAAAGGTTCAACCACGAGCGAAAACCTCGTTGTAGAAAAAGACGGAGAACCACTCAGTGGGTCAACCAAT
GAGCAGCTACAGAGTTTCTTAAGCGAATTAATTCCAATTGGTGTCGCGGATCTTTTCTTTTTCGATGGGG
AAAAAATAGCCGAACTGGCAGAAGATAATGCTAATGAAGCGTTGGCTGATGCAATTAACCGTCTATTAGG
TCTCGATATCGTAGAGCGTCTGCGTGCGGACTTGGGTATTTATCTAAGAGAACATGCTCAACAAAAGCTA
CCAAAAGATATATCCGCTGAAATAAAAAGCCTTGAGAATCAATATCAAGACTCTTACAAAAGTTATCAGG
ATAAATTAGACCTTGTTAGTGAATTAAAGACAAAAGCAGGCTCGGTCGAAGCCGATATAGAAGCTCTCAA
CGCTCGTTTAAACGATTTGGGCGGCGCCTGGGCTAAAACAAAAGAGAAAGAAGAGCATAGAGTTGATCGC
CTAGTCGAAGAAAAGAATAGGCTTAAATCAGAACTTACAGCGCTATTTAGTGAAGCATTCCCACTATCAC
TCGCTCCCAACACTTTAAACAATCTAATTAAAAAGCTAGATGCAGAGAAACAAACCAAGTCAAATCAAGC
TTCAAGAGCTAAAATAGAACTGAAGGTTCAAGAGTTGAAAGCTCAACTTGGTGAACTAGATAATGCAGGA
AAAGTGATTGATGACACCTTTTCCGACGTTTTGGATACATCCGGCGACGTTGATGTTATTCACGATATTT
CTGATTCAGATTACATGAATATACAGCAGTTAGCTGTTCATAAACTCCCGGAGCAATTAAAGCGATTTAA
AAAGCTTACAAAGGACCTGGAGGAAATTGAGTCTGAAATATCGGCAGCGGCTGACAATATAGCTCGAGCG
CCTGATGAAAGTAGACTAAAAGATATCCTAGACGAATTAGGAATCCAACAAAAGGAATTGGGCAAAGTTG
ACGCAGAAATCCAGCAAGAAAAAGACAATGCAAAGGCGCGCCTAAGAGCAGCTATCGATACAATGCGAAA
GCTTAAAGACCTAGATGCTAAGTACTCCACCTCAATGAGTTCCATCCAAGGAGTAAAACTGGCTTCCGAT
TCACGCGAACTACTACTGGAATTTGGGCGAATAACGAAAGATAGGAAGATAGAATTACTTGAACAAGAAT
TTATAAAGTCTTTTGGCAAGCTTGCTCGTAAAGACGATATGGAAATCCTAGCCAAGATCGATCCAAAAAC
GTTCTCAGTAACACTCAAGGATAAACATGGAAAGGAAATCAACAAGAAAAAACTATCAGCAGGCGAAAAA
CAAATTTTCGCTATTGCCATGCTAGAGGCACTGGGTAGAACTTCAGGTAGAAATCTCCCTGTTATTATTG
ATACACCATTAGGTAGGCTGGATTCACACCATAGAACTAAACTGGTCAAAAATTACTTTCCGACAGCGAG
CCATCAGGTGCTGATTCTCTCTACGGACACGGAAATTGACGAGAGCTTCTATAAAGACCTTTCACCTGAG
ATATCACATGCCTTTTATGTGGATTATGACCCCAATGAAGGCTCCTCCAAATATACTGAAGGCTACTTCT
GGCGTAAATAA