Summary Sequence Context  
1 homologue found:

HomologuedndE
OrganismOceanobacter sp. RED65
GID1069
PID2069
Locus tagRED65_14692
Locations46780..47118
Length339 bp
G+C%38
Link NCBI: gi:94499735  
SequenceATGTTACCAAATGAAATGAAAATCACTGATAATGCCTTTCATTCTCTTAGGCGCTTTCATTCAAATACTG
GAATAACGATCAATATAGGAGCTCGACTCGCTTTCTTTAAATCGATTGAAAGCGGGTACACTTATGATGG
GCGCGAAATGGAACCCCGCCAAAGATCCCTCAGTAAGCATGTTTGGCTAGGTGAACTAGAGCAAGTAGTT
GAGCTACTTCTGAAAGATAAGTATCCAGATATGCATCAAAAAGAATTATACAAGGCTTGGAATGCGCATG
TTGAAGATGGATCTGCAAGTATAGAAGGTAAAACAAATCTAAGTTCGTTTTTAGAATAG