Summary Sequence Alignment 16S rRNA Context  
5 homologues found:

HomologuedndA
OrganismBacillus cereus E33L
GID1004
PID2004
Locus tagBCZK0830
Locations957573..958703
Length1131 bp
G+C%34
Link NCBI: gi:52140164  
SequenceGTGATCTCTATGCTTTATCTTGATAATAGTGCAACAACACAATTATTACCTGAAGTTAAAGAAGTAATGT
TGCCATATTTACTTGAAGAATTCGGAAATCCTTCAAGTAAATATTACGGATTAGCCCAAAATGCTAAAGA
CGCTGTTGAAACAGCAAGAAAACATGTAGCTCAATTATTAGGCTGTGAAACTGATGAAGTAATCTTTACT
AGTGGTGCTACAGAAAGTAACAACTTTATTTTGAAAGGCATCGCTCATTATCATAAAGATAAAGGCAATC
ACATTATTACTTCTAAAGTAGAACATCCTTCTATCATAGAAACTTGTAAATTTTTAGAAGCAAATGGCTA
TACGGTCACATATCTTGATGTAGATCAATATGGCAGAATCAATTTGGAAGAACTAACTAAAGCTATTCAA
CAAGAAAAAACTCTTCTCGTTTCAATTATGTGGGGCAACAACGAACTTGGTTCTCTAAACCAAATCAACG
AGATCGCAAAAATCTGCAAAGAGAATGAAATATTCTTCCATACAGATGCTACACAAGTAGTTGGAAAAAT
ACAATTCTCTCTTTCAGATATAGACGGTATAAACTTTTTATCCTGCTCTTCTCATAAGTTTCATGGTCCA
AAAGGTATTGGGGTAACCATGATAGGTAAAGATAATTTAGGATTACCAATCCAAATCACTCCTCTACTTC
ACGGTGGCGGACAAGAACGTGATTTACGCAGTGGCACACTACCCGTCCATAATATTGTTGGAATGGGAAA
AGCTGCAGAAATCGCATATCTTAATTTGGAACAAAATATTTATAAATTAGAGCAACTAGAGAACAAATTA
GCTGATATTCTAAAAACCAAATTTCAAAATCATATTGAGTTTAACAATGATATTCAAGATAAAATACCTG
GAATATTAAGTGTTATATTTAAAGGTGTAAACAACGAAACGCTTGTGAGGACTCTTGCTCCAGTAGCTGC
CGTGTCTACTGGATCGGCTTGTAGCTCAAGTAAACCAAGTCATGTATTACAAGCTATCGGATTATCTATG
GATGATTTGCGTTCTACTATTAGGTTCTCACTTTCTTCTACTACTAGTTTAGAAGAGTTGGATGTTTTTA
ATAATCTATAA

HomologuedndB
OrganismBacillus cereus E33L
GID1017
PID2017
Locus tagBCZK0834
Locations962655..963749
Length1095 bp
G+C%34
Link NCBI: gi:52140164  
SequenceATGGATTATGGTTTTAGCTATAACTTCCCCGCTTTACGTGGAAAGCAAGGTGGTAAGGAGTACTTTGTTG
TAATGTGCCCTTTACGCTTAATTCCTAAAATATTTCTATTTGACGAGGAAGAAATCCCTGCTGAACATCG
TGCGCAAAGGATATTAAATAAAATTAGAATCCCAGAAATCACAAATTATATCATTGAAAATCAAAATGAT
TATGTTTTTTCATCCCTAACAGCATCTATAGATGGTGATATTGAATTCCAACCATTTAGTTCTGATCAGT
CGTTTCAAGATTTAGGACAACTTCGTATCTCACTGGATTCTAAGTTCCTGATTAATGATGGACAACACCG
AAGAGCAGCTATCGAAGAGGCGATAAAGCTTTCACCAGAATTAGGACATGAGACGATTTCGGTTGTGTTC
TATCATGATCAAGGTTTAAGAAATTCCCAACAAATTTTCTCAGATCTTAACCGCCATGCAGTTAATACAA
CTTCATCTATCGGTATTTTATATGATCATAGGGATAAGTTAGCATTAGTTACAAAAGAAATTGTCGAGGA
AAATGAATTACTATCTCGATATACCGACAAAGAAAAAGTCAATTTATCTAAAAACTCACCGAAGATTCTC
GCTTTAAATCACATATTTAATACAAACCTTCGATTACTAGGAAAGACAAAGGGTGACTTAATTACAGAAA
AAGAAGAACAATTCTTAAAAGAATTTTGGAACATTCTTTGTGATACAATAGTCGAATGGAATTTAGTTTA
CAAAAAAGAACTAAACCCTCGTGAACTTCGAATGCATTATATTGTCGGGCATGGAGTATTCATTGAATCT
GTTGGTTTAGTAGGAAAATATGTTTTTGAAAATCATCCAAAAGATTGGAAAAAATACATTTCTCTTTTAG
CAGACATCGACTACAGTCGTTCTAATTCTTCCGATTGGTTAGGACGAGCTTTCAATACAAATGGTCGCAT
ACAAAAGACAAAAGAAACAGTCACTTTAACCGCAAACAAACTAAAAGAAAAATTAGGTCTTCCTTTGACA
GAAGGAGAACAAAAGATAGAAGAGAAATTCCAGTTAGGAGCATGA

HomologuedndC
OrganismBacillus cereus E33L
GID1035
PID2035
Locus tagBCZK0833
Locations961084..962652
Length1569 bp
G+C%34
Link NCBI: gi:52140164  
SequenceATGTTAAATAATCTCATTACTGATTTAATAAATAATAAAAATGATTTTGTCTCTGAAGCAAAAGAGCATA
TAAAAAAAGTTTATCGTGCTGACGACCGCCCTTGGGTCGTTGGTTATAGTGGTGGAAAAGATTCCACAGT
TGTCGTTCAGCTTGTTTTTGAAGCTTTAAGTGAATTACCTACAGAGCAATTACACAAGAAAGTATATGTA
ATCTCATCAGATACACTTGTAGAAACACCGCTAATTATTCAATCTATCAATGTTACTTTACATCGAATCC
AAGAAGAAGCTTTAAAACGTGATCTTCCTATTGAAACGCATAAAGTAAAACCAAAATACGAACAATCTTT
TTGGGCTAATATTATCGGAAAAGGCTATCCATCACCAAACCAACAATTTCGCTGGTGTACAGATCGCTTA
AAAATTGAACCAGCAAATGCGTTTGTAATGGACAAAGTTTCTACGTTCGGTGAAGTAATCATGGTCCTTG
GTGTTCGTGAGAATGAAAGTGCTACTCGTGATAACGTTCTTAAATCCCATACCGTTGAAGGTAAAGATTT
AATGCGCCATTCCACGTTAACAAATGCATATGTTTTTGCACCGATTAGACAGTTTAGTTTAAATAACGTT
TGGGACTACTTACTGGAAAATCCATCTCCTTGGGGCAACGATAACCATGAATTAAATAAGCTTTATCAAG
ATTCAAGTAGTGGTGAATGCCCTCTTGTTGTAGATAAAACCATTAAAGAGAGTGCTGGTTCATGTGGAAA
CAGTCGCTTCGGTTGTTGGGTATGTACAGTAGTAAATGAAGATAAAGCATTAAACGGCTTCATTCTTAGT
GGATCAGATTGGATGAAACCTTTATTAGAATTCAGAAATTGGTTAGCTGGGATTCGGGATGATAGAACAT
TTCGTATGAAATACCGTAAAGGTGGTCAAATTTACTTTAACCCGCTAAAAACTGAAGTAAAAGATGATAT
TGAATATGTAATCATTCCAAAAAAATCTAGTCGTCCAAAACAAATGATTAAATTAGAAGAATTTACAATT
TTAGAAAGGGATGAACTAAAGTCTTATTTAGCAATAAACAATATTGATTTAAGTTCTCCTGAGGATCCAA
AAATTTTAGTAAAGCTTGATAATAATCAAATCGGACAACTTGGTTTAGGTCCCTTTACACTGAACGCGCG
AAAAGAGATTTTACGCAGACTTCTTATTGTCCAAAGAGATTTACAACATCCTGAAGAAGAGGATTTTGAA
TTAATTAAAGAAGAAGAATTACGTGTTATTCGTCGTTACTGGTTAGAAAATGGCGATTGGGAAGATTCTT
TACCTAGCATTTTTAAAGAGGTAATGGGATATGACCTAAACTGGGAGTATGATGATCGTCCATTATTTGA
TAATGAACAAATTACAGATTTAGAATCATTATGTAGCAAACACAACGTAGACTTTAAAGCATTAAAAAAA
CTTATATCACTTGAAAAAGATTTTTCAGGTTATAAAGTTCGTCGTGGATTAATGAACGAAATTGAAAAAG
TACTAAAGCAAGACTACTTACATTTGTAG

HomologuedndD
OrganismBacillus cereus E33L
GID1053
PID2053
Locus tagBCZK0832
Locations959077..961068
Length1992 bp
G+C%30
Link NCBI: gi:52140164  
SequenceATGTTAATTGAACAACTAGAATTAGAAAACATAGGAGCTTATACGGAAAGAAATACCTTCGATCTGTCTA
TCTCCTCCCCAAAAAAGAAAGTAATTTTAATAGGCGGAGAAAATGGTGCTGGGAAAACAACATTTTTAAA
TTCCATAAAACTAGGATTATTTGGTTGTTTCGGCTATGGATATAAGACAGAGAATAATGATTACTATAAG
CGCGTCCATGGGTATTTAAATGCTTCTGCTCGTAAAGATGAGACAAATCCTTTTAGTATTACAATTACCT
TTAGTGAAGTAGAAAATTACAAACGCCATGTTTATACATTCAAAAGATCTTGGAACATTTTAAACAGCGC
TATAAAAGAAAAATTCACTGTAAAAAAAGATGGTCATTATTTAAATGATGCTGAAAAAGATATTTTCGAA
TCAAGACTACGAGAGAATTTCCCGCCTAAATTATTTGATCTATGCTTATTTGATGGCGAAGAAATTTCAA
AAATAATAAATGAAAATAAATTATCCTCTTATTTAAAAGAATTATCTACTGTTATATTCAACTTAGATTT
ATTCCGAAATTTAGAAGGTGATTTGACCAACTATTTACAACAAGAAATTGATCAAGAACATCTTTCCTCT
ATAGAAAGCGAAATCCTTACCCTTCAGCGTCAAGAGAAAGAACAGTCTTTAAAAATTGAAGATCTTGAAG
ACACAATTAAAACAGCGCAGCAGCAAATAGAAGAATCAAAAGAATCTTATTCTTTATTGAAAAAGGATTT
TGAAACACATGGTGGTTTAATTAAAGAAGAACGTGAAACGTTAAATAGACAAGTATTAGAAATTGAAGCA
CATCGAAAAGCTAATTCTGAAAAAGTTCGAGAATTTATTCAAACGCTTTTACCTTTCTATCTAAACAAAA
ACTTATTACTATCTACTAAAAATCAATTACAAAATGAAGAAAAACTATCATTAGCAAACCAATTAACTTC
AGAGTTAACTGAAGAACGCGCTCTTGAATTAGCTAAAAGTTTACCTGGAGTCTCAGCTCCTAATGATTTA
GCAGCTGAATTGAGAAAACAAATTTTCAATATTATTAAGCCTAATGATACAGATGTTGAGTATATCCATA
GAGTTTCACCAACACAACGCACACAATTCGAAGTAGCGGCACAACAAGTTGAAAGAGAATCTCATGACAC
ATATATGCAATTACTTCAAGAAAATAGAGAAAACTTACTTCAAGCACAAGAACTAAGAAAGAAAATTTCT
ACTAATGATTCTACAAATGAGTTTGCACAAATGTTAGAAACTATGACTCAAACACAAGAAAAAATCTTTA
AGTTAGAAAAAGAAGTAGAAGAAAACTTAAGTATTTTAGAAACTAGACAAGAGACTTTAGAAGCATTAAA
AAATACAATCGACTCAAAACAGAATATTGTACAACAAAGTAACAAAACGAGAAATACATTCTTAATTGCC
CAAAGTATTATGAAATTAAGTACAGAGTTTCAAATGTTACAACATCAAAAGAAATTACAACAAGTACAAA
TCGAAGCTACAAAAATGTTGAATAAATTAATGCGTAAACACCAATATATTTCTTCTTTACGCATTGATTC
TAGCACGTTTGAAGTAACTTTATATGATAATAATCGTGACCATGTAGCAAAAGAAACATTATCAGCAGGT
GAAAAAGAAATTCTCTTACTATCATTAATTTGGGCAATGTTCAAATGTTCTGGTCGTCGTGTTCCATTCA
TATTCGATACACTTTTAGGTCGCCTTGATCAAACACATAAACATAATATTTTAGTAGATTTCATCCCTGC
ATGTGGTGAGCAAGTCTTAATCTTGTCAACTAACTCTGAAGTTGATGAAAAACACTATAATTTACTGAAA
AACTTTGTATCCCATGGATACTTATTAGAATTTGATACAGAACTACGAAAAGTGAATGTTACAGATCAAT
ATTTCAACTTTAATAAGGAGCAAGCAAAATGA

HomologuedndE
OrganismBacillus cereus E33L
GID1070
PID2070
Locus tagBCZK0831
Locations958700..959080
Length381 bp
G+C%34
Link NCBI: gi:52140164  
SequenceATGAACTACCGTTTAAAGATTTCTAAAAGAGTATCAGATAAACTAAAAGAATTACAAGCTCCTACTAATT
TAACACCAAATATTTTAGCTCGTTTAGCAGTTGGATTATCTTTAACTGATCCAACTTTTCCTGAGGTTTT
AACAGATAAAGAAGCCGGTGGATTAGAAATCAATCGCCACACATTAACTGGAGAATATGATTTTATTTAT
AAATGCTTAATCACTCAGCATGCGGGACGTGAAGTATCTGATAATGAATACTTTCCTACCCTATTCAACG
CTCACTTAGAACGCGGAATTAACTTATTAGACAGCGAATATAAACATGCTGGAAACAACGAGAAATTCAC
AATGAACTTGCTAAAATACGGTAAGGAGTGA