Summary Sequence Context  
1 homologue found:

HomologuedndA
OrganismBacillus cereus E33L
GID1004
PID2004
Locus tagBCZK0830
Locations957573..958703
Length1131 bp
G+C%34
Link NCBI: gi:52140164  
SequenceGTGATCTCTATGCTTTATCTTGATAATAGTGCAACAACACAATTATTACCTGAAGTTAAAGAAGTAATGT
TGCCATATTTACTTGAAGAATTCGGAAATCCTTCAAGTAAATATTACGGATTAGCCCAAAATGCTAAAGA
CGCTGTTGAAACAGCAAGAAAACATGTAGCTCAATTATTAGGCTGTGAAACTGATGAAGTAATCTTTACT
AGTGGTGCTACAGAAAGTAACAACTTTATTTTGAAAGGCATCGCTCATTATCATAAAGATAAAGGCAATC
ACATTATTACTTCTAAAGTAGAACATCCTTCTATCATAGAAACTTGTAAATTTTTAGAAGCAAATGGCTA
TACGGTCACATATCTTGATGTAGATCAATATGGCAGAATCAATTTGGAAGAACTAACTAAAGCTATTCAA
CAAGAAAAAACTCTTCTCGTTTCAATTATGTGGGGCAACAACGAACTTGGTTCTCTAAACCAAATCAACG
AGATCGCAAAAATCTGCAAAGAGAATGAAATATTCTTCCATACAGATGCTACACAAGTAGTTGGAAAAAT
ACAATTCTCTCTTTCAGATATAGACGGTATAAACTTTTTATCCTGCTCTTCTCATAAGTTTCATGGTCCA
AAAGGTATTGGGGTAACCATGATAGGTAAAGATAATTTAGGATTACCAATCCAAATCACTCCTCTACTTC
ACGGTGGCGGACAAGAACGTGATTTACGCAGTGGCACACTACCCGTCCATAATATTGTTGGAATGGGAAA
AGCTGCAGAAATCGCATATCTTAATTTGGAACAAAATATTTATAAATTAGAGCAACTAGAGAACAAATTA
GCTGATATTCTAAAAACCAAATTTCAAAATCATATTGAGTTTAACAATGATATTCAAGATAAAATACCTG
GAATATTAAGTGTTATATTTAAAGGTGTAAACAACGAAACGCTTGTGAGGACTCTTGCTCCAGTAGCTGC
CGTGTCTACTGGATCGGCTTGTAGCTCAAGTAAACCAAGTCATGTATTACAAGCTATCGGATTATCTATG
GATGATTTGCGTTCTACTATTAGGTTCTCACTTTCTTCTACTACTAGTTTAGAAGAGTTGGATGTTTTTA
ATAATCTATAA