Summary Sequence Context  
1 homologue found:

HomologuedndB
OrganismBacillus cereus E33L
GID1017
PID2017
Locus tagBCZK0834
Locations962655..963749
Length1095 bp
G+C%34
Link NCBI: gi:52140164  
SequenceATGGATTATGGTTTTAGCTATAACTTCCCCGCTTTACGTGGAAAGCAAGGTGGTAAGGAGTACTTTGTTG
TAATGTGCCCTTTACGCTTAATTCCTAAAATATTTCTATTTGACGAGGAAGAAATCCCTGCTGAACATCG
TGCGCAAAGGATATTAAATAAAATTAGAATCCCAGAAATCACAAATTATATCATTGAAAATCAAAATGAT
TATGTTTTTTCATCCCTAACAGCATCTATAGATGGTGATATTGAATTCCAACCATTTAGTTCTGATCAGT
CGTTTCAAGATTTAGGACAACTTCGTATCTCACTGGATTCTAAGTTCCTGATTAATGATGGACAACACCG
AAGAGCAGCTATCGAAGAGGCGATAAAGCTTTCACCAGAATTAGGACATGAGACGATTTCGGTTGTGTTC
TATCATGATCAAGGTTTAAGAAATTCCCAACAAATTTTCTCAGATCTTAACCGCCATGCAGTTAATACAA
CTTCATCTATCGGTATTTTATATGATCATAGGGATAAGTTAGCATTAGTTACAAAAGAAATTGTCGAGGA
AAATGAATTACTATCTCGATATACCGACAAAGAAAAAGTCAATTTATCTAAAAACTCACCGAAGATTCTC
GCTTTAAATCACATATTTAATACAAACCTTCGATTACTAGGAAAGACAAAGGGTGACTTAATTACAGAAA
AAGAAGAACAATTCTTAAAAGAATTTTGGAACATTCTTTGTGATACAATAGTCGAATGGAATTTAGTTTA
CAAAAAAGAACTAAACCCTCGTGAACTTCGAATGCATTATATTGTCGGGCATGGAGTATTCATTGAATCT
GTTGGTTTAGTAGGAAAATATGTTTTTGAAAATCATCCAAAAGATTGGAAAAAATACATTTCTCTTTTAG
CAGACATCGACTACAGTCGTTCTAATTCTTCCGATTGGTTAGGACGAGCTTTCAATACAAATGGTCGCAT
ACAAAAGACAAAAGAAACAGTCACTTTAACCGCAAACAAACTAAAAGAAAAATTAGGTCTTCCTTTGACA
GAAGGAGAACAAAAGATAGAAGAGAAATTCCAGTTAGGAGCATGA