Summary Sequence Context  
1 homologue found:

HomologuedndC
OrganismBacillus cereus E33L
GID1035
PID2035
Locus tagBCZK0833
Locations961084..962652
Length1569 bp
G+C%34
Link NCBI: gi:52140164  
SequenceATGTTAAATAATCTCATTACTGATTTAATAAATAATAAAAATGATTTTGTCTCTGAAGCAAAAGAGCATA
TAAAAAAAGTTTATCGTGCTGACGACCGCCCTTGGGTCGTTGGTTATAGTGGTGGAAAAGATTCCACAGT
TGTCGTTCAGCTTGTTTTTGAAGCTTTAAGTGAATTACCTACAGAGCAATTACACAAGAAAGTATATGTA
ATCTCATCAGATACACTTGTAGAAACACCGCTAATTATTCAATCTATCAATGTTACTTTACATCGAATCC
AAGAAGAAGCTTTAAAACGTGATCTTCCTATTGAAACGCATAAAGTAAAACCAAAATACGAACAATCTTT
TTGGGCTAATATTATCGGAAAAGGCTATCCATCACCAAACCAACAATTTCGCTGGTGTACAGATCGCTTA
AAAATTGAACCAGCAAATGCGTTTGTAATGGACAAAGTTTCTACGTTCGGTGAAGTAATCATGGTCCTTG
GTGTTCGTGAGAATGAAAGTGCTACTCGTGATAACGTTCTTAAATCCCATACCGTTGAAGGTAAAGATTT
AATGCGCCATTCCACGTTAACAAATGCATATGTTTTTGCACCGATTAGACAGTTTAGTTTAAATAACGTT
TGGGACTACTTACTGGAAAATCCATCTCCTTGGGGCAACGATAACCATGAATTAAATAAGCTTTATCAAG
ATTCAAGTAGTGGTGAATGCCCTCTTGTTGTAGATAAAACCATTAAAGAGAGTGCTGGTTCATGTGGAAA
CAGTCGCTTCGGTTGTTGGGTATGTACAGTAGTAAATGAAGATAAAGCATTAAACGGCTTCATTCTTAGT
GGATCAGATTGGATGAAACCTTTATTAGAATTCAGAAATTGGTTAGCTGGGATTCGGGATGATAGAACAT
TTCGTATGAAATACCGTAAAGGTGGTCAAATTTACTTTAACCCGCTAAAAACTGAAGTAAAAGATGATAT
TGAATATGTAATCATTCCAAAAAAATCTAGTCGTCCAAAACAAATGATTAAATTAGAAGAATTTACAATT
TTAGAAAGGGATGAACTAAAGTCTTATTTAGCAATAAACAATATTGATTTAAGTTCTCCTGAGGATCCAA
AAATTTTAGTAAAGCTTGATAATAATCAAATCGGACAACTTGGTTTAGGTCCCTTTACACTGAACGCGCG
AAAAGAGATTTTACGCAGACTTCTTATTGTCCAAAGAGATTTACAACATCCTGAAGAAGAGGATTTTGAA
TTAATTAAAGAAGAAGAATTACGTGTTATTCGTCGTTACTGGTTAGAAAATGGCGATTGGGAAGATTCTT
TACCTAGCATTTTTAAAGAGGTAATGGGATATGACCTAAACTGGGAGTATGATGATCGTCCATTATTTGA
TAATGAACAAATTACAGATTTAGAATCATTATGTAGCAAACACAACGTAGACTTTAAAGCATTAAAAAAA
CTTATATCACTTGAAAAAGATTTTTCAGGTTATAAAGTTCGTCGTGGATTAATGAACGAAATTGAAAAAG
TACTAAAGCAAGACTACTTACATTTGTAG