Summary Sequence Context  
1 homologue found:

HomologuedndD
OrganismBacillus cereus E33L
GID1053
PID2053
Locus tagBCZK0832
Locations959077..961068
Length1992 bp
G+C%30
Link NCBI: gi:52140164  
SequenceATGTTAATTGAACAACTAGAATTAGAAAACATAGGAGCTTATACGGAAAGAAATACCTTCGATCTGTCTA
TCTCCTCCCCAAAAAAGAAAGTAATTTTAATAGGCGGAGAAAATGGTGCTGGGAAAACAACATTTTTAAA
TTCCATAAAACTAGGATTATTTGGTTGTTTCGGCTATGGATATAAGACAGAGAATAATGATTACTATAAG
CGCGTCCATGGGTATTTAAATGCTTCTGCTCGTAAAGATGAGACAAATCCTTTTAGTATTACAATTACCT
TTAGTGAAGTAGAAAATTACAAACGCCATGTTTATACATTCAAAAGATCTTGGAACATTTTAAACAGCGC
TATAAAAGAAAAATTCACTGTAAAAAAAGATGGTCATTATTTAAATGATGCTGAAAAAGATATTTTCGAA
TCAAGACTACGAGAGAATTTCCCGCCTAAATTATTTGATCTATGCTTATTTGATGGCGAAGAAATTTCAA
AAATAATAAATGAAAATAAATTATCCTCTTATTTAAAAGAATTATCTACTGTTATATTCAACTTAGATTT
ATTCCGAAATTTAGAAGGTGATTTGACCAACTATTTACAACAAGAAATTGATCAAGAACATCTTTCCTCT
ATAGAAAGCGAAATCCTTACCCTTCAGCGTCAAGAGAAAGAACAGTCTTTAAAAATTGAAGATCTTGAAG
ACACAATTAAAACAGCGCAGCAGCAAATAGAAGAATCAAAAGAATCTTATTCTTTATTGAAAAAGGATTT
TGAAACACATGGTGGTTTAATTAAAGAAGAACGTGAAACGTTAAATAGACAAGTATTAGAAATTGAAGCA
CATCGAAAAGCTAATTCTGAAAAAGTTCGAGAATTTATTCAAACGCTTTTACCTTTCTATCTAAACAAAA
ACTTATTACTATCTACTAAAAATCAATTACAAAATGAAGAAAAACTATCATTAGCAAACCAATTAACTTC
AGAGTTAACTGAAGAACGCGCTCTTGAATTAGCTAAAAGTTTACCTGGAGTCTCAGCTCCTAATGATTTA
GCAGCTGAATTGAGAAAACAAATTTTCAATATTATTAAGCCTAATGATACAGATGTTGAGTATATCCATA
GAGTTTCACCAACACAACGCACACAATTCGAAGTAGCGGCACAACAAGTTGAAAGAGAATCTCATGACAC
ATATATGCAATTACTTCAAGAAAATAGAGAAAACTTACTTCAAGCACAAGAACTAAGAAAGAAAATTTCT
ACTAATGATTCTACAAATGAGTTTGCACAAATGTTAGAAACTATGACTCAAACACAAGAAAAAATCTTTA
AGTTAGAAAAAGAAGTAGAAGAAAACTTAAGTATTTTAGAAACTAGACAAGAGACTTTAGAAGCATTAAA
AAATACAATCGACTCAAAACAGAATATTGTACAACAAAGTAACAAAACGAGAAATACATTCTTAATTGCC
CAAAGTATTATGAAATTAAGTACAGAGTTTCAAATGTTACAACATCAAAAGAAATTACAACAAGTACAAA
TCGAAGCTACAAAAATGTTGAATAAATTAATGCGTAAACACCAATATATTTCTTCTTTACGCATTGATTC
TAGCACGTTTGAAGTAACTTTATATGATAATAATCGTGACCATGTAGCAAAAGAAACATTATCAGCAGGT
GAAAAAGAAATTCTCTTACTATCATTAATTTGGGCAATGTTCAAATGTTCTGGTCGTCGTGTTCCATTCA
TATTCGATACACTTTTAGGTCGCCTTGATCAAACACATAAACATAATATTTTAGTAGATTTCATCCCTGC
ATGTGGTGAGCAAGTCTTAATCTTGTCAACTAACTCTGAAGTTGATGAAAAACACTATAATTTACTGAAA
AACTTTGTATCCCATGGATACTTATTAGAATTTGATACAGAACTACGAAAAGTGAATGTTACAGATCAAT
ATTTCAACTTTAATAAGGAGCAAGCAAAATGA