Summary Sequence Context  
1 homologue found:

HomologuedndE
OrganismBacillus cereus E33L
GID1070
PID2070
Locus tagBCZK0831
Locations958700..959080
Length381 bp
G+C%34
Link NCBI: gi:52140164  
SequenceATGAACTACCGTTTAAAGATTTCTAAAAGAGTATCAGATAAACTAAAAGAATTACAAGCTCCTACTAATT
TAACACCAAATATTTTAGCTCGTTTAGCAGTTGGATTATCTTTAACTGATCCAACTTTTCCTGAGGTTTT
AACAGATAAAGAAGCCGGTGGATTAGAAATCAATCGCCACACATTAACTGGAGAATATGATTTTATTTAT
AAATGCTTAATCACTCAGCATGCGGGACGTGAAGTATCTGATAATGAATACTTTCCTACCCTATTCAACG
CTCACTTAGAACGCGGAATTAACTTATTAGACAGCGAATATAAACATGCTGGAAACAACGAGAAATTCAC
AATGAACTTGCTAAAATACGGTAAGGAGTGA