Summary Sequence Alignment 16S rRNA Context  
5 homologues found:

HomologuedndA
OrganismGeobacter uraniireducens Rf4
GID1005
PID2005
Locus tagGura_2472
Locations2855211 ..2856344
Length1134 bp
G+C%53.5
Link NCBI: gi:148262085  
SequenceATGGGAACTATCTATCTGGATTGCAATGCTACCACCCCCCTGGATGCTGAGGTTCGAGAGGTAATGCTCC
GTTACCTGACAGAGGACTTCGGCAATGAGGGGAGCCGTACCCACGAATTCGGCGCACGGGCTAAACAGGC
GGTGCAGAAAGCGCGGGATCAGGTAGCCGCTGTAGTTTCAGCCAAGCGTGACGAGGTGATTTTTACCAGC
GGCGCGACGGAGAGCAACAACCTTGCAATTCTCGGTTTACGGGCTGCGGGAGAGGAGCAGGGGAAGAAAC
ACGTTATCACCACGGCCATTGAACACAAGGCCGTGCTGGAGCCATGCGATGCCCTTGAACGGGCTGGTTT
TGCAGTAACACGAGTGCCTGTTGGCGCTGGTGGTGTGGTGGAACTGGAAGCGATAAAAGCTGCTCTACGG
CCGGATACACTGCTGGTTTCAGTCATGCAGACGAATAATGAAACCGGTATCCGCCAGCCATTGGATGATA
TTGCCGAAATACTAAAGAATCATCCTGCCTACTTCCACACCGATGCGGCGCAGGGTTTTGGTAAGGATTT
AGAGCTACTACGTAATCTACGGATCGATCTCATCAGTATCAGCGGACATAAAATTTATGCACCAAAGGGA
ATCGGCGCCTTAGTCATGCGGAGGCGTGGCTATGAGCGCATACTACTGCAACCACTCGTCTATGGTGGGG
GGCAGGAGCGTGGCCTGCGGCCGGGAACATTGCCGGTAGCACTGATAGCTGCCCTTGGAACGGCAGCCGA
GATTGCTGTGCGTGATAACGAAAAACGGAGAGAAGCCTGCCGGTGCATGCGGGAAAATGCGTTGAAGGCC
TTATCACCTCTTGAACCGAAATTGACTGGCGAGCAGTCCTTGGCGATGGATCATGTTCTTAACCTGGCCT
TTCCCGGTCTTGATTCTGAAGCCCTGATAGTTGCCCTGAAGGATTTGATTGCGATCTCCAACGGCTCGGC
GTGCACATCGAGTAATTATACACCAAGTCATGTGTTGAAGGCGATGGGTATGAGCGATGACGAAGCGAAT
GCCTGCGTCCGCCTCAGCTGGTGTCATATGACAACGGAGATTGATTGGGATGCCGTGGCTTGTAGAATAT
CTTCGCTGAGATAG

HomologuedndB
OrganismGeobacter uraniireducens Rf4
GID1018
PID2018
Locus tagGura_2473
Locations2856477..2857553
Length1077 bp
G+C%52.6
Link NCBI: gi:148262085  
SequenceATGGATACGAACTCTACCCTTTCATTCCCAGTTATTCGCGGACTACAGGCCCATCGCGAATATTACGTTG
CCATGTGGACACTCCGGATGATGAGGCAAATTTCGATATTCAATGAAGATGAACTCCCTCCGGAACTACG
CGCCCAGCGAATCCTCAACAAGGCGCGCATACCGGAAATCGCCGAGTATATCATCGACAACCCGGATGAT
TATGTTTTTTCTGCCCTCACCGTTTCAATCGATTCCGACGTCCTGTTTGAGCCGCTCCCCGGCCAGGATA
AACTCGGTCTGCTCCGCGTCCCAATGGATGCCCATTTCATCATCAACGATGGCCAGCACCGCCGGGCCGC
TATTATCGAGGCACTGAAGCAACGACCCGAACTGGAACACGAAACAATCGCCGTAGTCTTTTTCCTAGAC
ATAGGCCTGGAGCGCTGCCAGCAGATGTTTGCCGACCTCAATCGCTACGCCATCCGTCCGAGCCGCTCGC
TGGGCCTGCTGTACGACCACCGCAACGACAAGGCCCGCTTGGCAAAAATGGTTATCATGAAATCGGAAAT
CTTCCGTGACCTGGTGGACATGGAGAAATCCTCTCTCGCCCCCCGCGCCCGAAAACTCTTCACACTCTCC
GCATTTTACAACGCCTGTGCCGATCTTGTTAACGGCTTAGCTACTGGCAATCTGATAGAAGACGCAGATC
TTGCCCGCACATTTTGGGAGGAGACAGCCAAGCATTTCCCTATGTGGGAGCAAGTGCGCGAGGGGAAACT
TCCTGCCAGTGAGGTGAGGGAAGGATTTATCCACTCCCATGGAATTGCGCTCCAGGCCATCGGCAAGGCG
GGAAATGCTCTTCTGCACAGCCATCCAAACGACTGGAAAAAACGACTGAAAGCCCTGGAAAAAATCGATT
GGTCGCGCAACAATGCCAAGATATGGGAAGGCAGAGCCATAATTGGCGGCAAAGTCTCCAAATCCACCAC
TAACGTCGTCCTGGCCACAAATGTCATAAAGAAAGCCTTATCGCTCTCTCTCAGCGAAGAAGAACAGCGA
GTCGAAACAGCACACCTCAAAAAGTAA

HomologuedndC
OrganismGeobacter uraniireducens Rf4
GID1036
PID2036
Locus tagGura_2474
Locations2857578..2859233
Length1656 bp
G+C%53
Link NCBI: gi:148262085  
SequenceATGAAAACAGCAAAAAAGAAAGCTGGTGTTCCAGCAACAAATGATTCTGTACAACCTGAATGTACGGTAA
CTGAAACATCTCTTCCCAACACAGACAACTCAAATTCGCCAGCTGCAAAGGTCCGCAAATCGGCCTTCAA
TGAACTCGGTTTCCAGGCGACCATCGAGCTGCTTCAGGAAGAAATCCGTAGCCTCTACATTGCCGACGAA
ATCCCCTGGATCATCGGCTATTCCGGCGGCAAGGATTCCACCGCAACCCTCCAACTGGTTTGGACCGCCA
TCGCAGAACTTCCTGCTGAACAGCGCCGGAAAACGGTCTATGCAATCTCCACCGACACCATGGTGGAAAA
TCCGGTCGTAGCTGCATGGGTGGCTAATTCGCTCGCTGTCATGAAGCGAGCTTCTGCCGAGCAACTGGTA
CCCATACAACCTCGCCGCCTGACACCGGCTTTGGTAGATTCTTTCTGGGTCAATTTGATCGGGAAAGGGT
ATCCTGCCCCTCGACACAAATTCCGCTGGTGCACGGCCCGCCTGAAAATTTCACCCTCCAACTCCTTCAT
CAACAGCATCGTATCTTCAAGTGTCGAAGCCATTCTCGTCCTTGGTACTAGAAAGGCAGAGAGCTCAGCC
CGTGCAGCCAACATGGCTCGACATGAAAAGGGACGAGTCCGGGATCGGCTCAGTCCCAATTCCAGCTTAC
CTGGCTCACTCGTCTACTCTCCCATTGAGGCTTGGACAAACGACGATGTCTGGTTTTATCTCATGCAAGT
TAAAAATCCGTGGGGCTACAACAATCGGGATCTGCTTGGCATGTATGCCGGGGCATCTGCTGATGGCGAG
TGTCCGCTCGTCGTAGATGATTCAACGCCGAGTTGCGGTGACTCACGTTTTGGCTGCTGGGTCTGCACCC
TGGTGGACAAAGACAAGTCCATGACCGCCATGATTCAGAATGACGAAGAAAAAGAATGGATGATGCCACT
GCTCGATATCCGCGACGCTCTGGATTTCCGCAGAGACCACAAGGGCGAATACGCTGAAAATGCTGATTAT
GACATCCGCGATTTTCGCCGCATGAGCGGTGCCGTCCAAGTGATGTCGGGTGGCCGCCCAATTCCCGGAC
CCTACATTCAGAGCGCTCGGGAAGAATGGCTTAGGAAGTTGCTCATTGCCCAAACCTACATCCGCAAAAA
CGGCCCACCCGAAGTACAAGGGATAGAACTGATAACCCTGGAAGAGTTACAGGAGATCCGTCGTATCTGG
GTGGTAGACAAGCACGAACTGGAAGACTCTCTGCCCCGCATTTACCGGGAAGCTACCGGCAATGATTACC
CAGGCCGCCCACTAGATGACAATCTGGTGATTGGCGAGGAAGAAATGCACGTTCTTGCCGAACTATGCGG
AGAAGATCGCCTGCACTATGAGCTTACGCGCGAACTATTGAGTATAACCCGGCAACAACGGACAACCTCC
CGTCGTGCCGGTCTTCATGAGCAACTAGAGAAGACCTTTTCCCGCCATTTTTACGACGACAAGCAGGACG
CCCTCACCCGCGCCCAGCAGATGGCCGATCAAAAGCAACGTTTGTCCAATAATCGCCAGCAGTTCGTTTC
GGTCGTCATGGAACCTTTGGCCTGCGATCAGGAGGGCGAAGCATGA

HomologuedndD
OrganismGeobacter uraniireducens Rf4
GID1054
PID2054
Locus tagGura_2475
Locations2859230..2861206
Length1977 bp
G+C%52.3
Link NCBI: gi:148262085  
SequenceATGATACTGGATACGATCATACTGGAAAACTATGGTGCTTACGGTGGACGGCAGGAAGCTCTCCTTACTC
CTGAAGAGGGGAAGCCTATCATCCTTTTCGGTGGTATGAACGGCGGCGGTAAAACAACCCTGCTCGACGC
TATTCAACTGGCCTTCTATGGGCCAAAGGCGCGTATCTCCAACCGGGGCAAGCTTGGCTATAAGGAGTAC
CTCCGGGAATCGATCCACCGCGGCGGAGATCCGGGCGAAGGGGCCGGCATCACGGTGCGCTTCCGCCGGG
TCATCGAAGGTAAAAGTAGAAATTTCGAATTACAACGTTGCTGGCGTGAAGGGGTTAAAGGAATCGAGGA
AACTGTTAGGGTCCTTCGTGATGGCCTCCCCGATGATATATTCACCGAACATTGGGATGAATCCATCGAA
GCCTATCTCCCCAGCAGTATCGCCCACCTCTTCTTCTTTGACGGCGAACAGATCAAGGAGTTGGCCGAGG
GTGGCCACGCTGCTGATATTCTCGGCACAGCCATCCACTCCCTGCTGGGTCTTGATTTGGTTGATCGCCT
GGAAAACGATCTCAAGGTGTTTGAACGGCGCAAGAAAGCCGAAGGACTCGACCCCGAAGCAACAAGGAAG
CTAGCAATTGCGCGAAGTGAGTTCGTTGAAATCTTCCGGGAGGAGGAAAAGGCCGCTTCGTTGTCGGGTG
CACTCACCAATGAATCAAACCAACTTGCAAAGGAATTGCATGCTAAAGAAGAATTATTCCGGAAGGAAGG
TGGCGATCTTTTTTTACGGCGCAAAGAGCTGGAAGATGAGCTAGTCGCACTGAAGGCCCGGAAAGCAGCA
ACAGAGGCGCAATTCCGAGAGCTGATCGCTGGACCGCTGCCGTTCCTTCTGGTGGAAAACCTGCTTGCCG
AAGTGGAGCAGGTCGTTCGTCATGAAACCGAAATAAAGCGTGCTCGGGTATTGTTGGAGGTATTGGAAAC
CCGCGACACTGAGGTGCTGGACTCCCTGAAAGCGGAAAAGATCGGTGGGCAGCTACTTCGCTCCATGGAC
AGGATTCTGGAAAAAGACCGCAAAAGCAGGGCCGGACTAGCGAAGAAAACATTAATTCTCGACGCAGATG
ACACTCTGGCCCCGCAGATAGCCCATTTGCGTGGGACCGTACTCCCGACAGCCGAACAACAGGCGTGTGA
CTTCACTGCAAAAATTGCTGCCTTGGACGAGAAAATTGCCCGACTGGAAGGTGAACTGGATCGTGCTCCG
ACTGCGGAGCGGATTGCAGAAGTTCAAGAGGTGCTGGAAGCAGCCCGAAAAGCCCATCAGGCTAAACTGG
CTGAACTTGAGGCGATAAAGGTGCGCCGCCAGGCGTTACAGCGGCAACGACTGATGGCGGAAGCCAGGTT
AGACAAGATGGGAGAAAATGATGTTAATTCCCAATTCCATGAGGATGGCCGCCTGCGGATGCTTAAACAC
TCGCTTCGGGTGCGTGAGACTCTTGGGCGATTCCGCACTAAGATCGTAAAACATCACACTGAGAACATGG
AATCGCTGATGCTTGAATCCTTCTGCAAGCTGCTCCGTAAGAAGGAGTTGGTTAGTGGACTAAAGATAAA
TCCTGAGACATTCGAGGCCACGCTTGTAACCAAGGATGGGAAGATCCTCCCCTTTGAACGTCTTTCCGCT
GGCGAAAAGCAACTCCTAGCAACGTCACTTCTCTGGGGTCTTGCTCGCGCTTCCGGACGCCCTGTGCCAA
CAATTATTGACACTCCACTGGGGCGGCTCGACTCTTCACACCGTAAGCATCTGATAGAACGCTACTTCCC
GAATGCCTCCCATCAGGTTCTATTGTTGTCTACAGATGAGGAGATTGTTGGGACTTATTACAAGGAACTG
AAACCCTTCATAACCAGAACCTATCTTCTTGAGCACAACGAGGAGGCGGGGCAAACAAATCTTAAGCAAG
GATACTTCAACGTATGA

HomologuedndE
OrganismGeobacter uraniireducens Rf4
GID1081
PID2081
Locus tagGura_2476
Locations2861203..2861601
Length399 bp
G+C%40.3
Link NCBI: gi:148262085  
SequenceATGAGACCACCAGTTGAGCATGTGCGAGTTAGCACTAAGGGGAAAGAAATATTAATCAAGATAAAAAGAC
GTACAGGTCTAGAGCATTGGAACGAAGTATGTAGAGTGGCACTTTGCCATTCGCTTTCAAATCCAACATC
GCCTCCGAAGCTTGAAAGAGTCAGTGACAGCACAATCGATATTGAATGGAAAACGTTCGCAGGACAGTAT
CAAAAAGAATTTGCTGCTATGATCATGCTTAGGAGCAAGCAACATGGCATAAATATAAACGATAGAGAGG
AAATAGCTCAATATTTTCGATCTCACCTAGAGAGAGGAATCGTGTCCTTGCAGACTAGCAAAGATGTTAG
CAGCTTGTTCCATTATTCTCAGCATTTTGAGTTGAAAGATAATCCATGA