Summary Sequence Context  
1 homologue found:

HomologuedndA
OrganismGeobacter uraniireducens Rf4
GID1005
PID2005
Locus tagGura_2472
Locations2855211 ..2856344
Length1134 bp
G+C%53.5
Link NCBI: gi:148262085  
SequenceATGGGAACTATCTATCTGGATTGCAATGCTACCACCCCCCTGGATGCTGAGGTTCGAGAGGTAATGCTCC
GTTACCTGACAGAGGACTTCGGCAATGAGGGGAGCCGTACCCACGAATTCGGCGCACGGGCTAAACAGGC
GGTGCAGAAAGCGCGGGATCAGGTAGCCGCTGTAGTTTCAGCCAAGCGTGACGAGGTGATTTTTACCAGC
GGCGCGACGGAGAGCAACAACCTTGCAATTCTCGGTTTACGGGCTGCGGGAGAGGAGCAGGGGAAGAAAC
ACGTTATCACCACGGCCATTGAACACAAGGCCGTGCTGGAGCCATGCGATGCCCTTGAACGGGCTGGTTT
TGCAGTAACACGAGTGCCTGTTGGCGCTGGTGGTGTGGTGGAACTGGAAGCGATAAAAGCTGCTCTACGG
CCGGATACACTGCTGGTTTCAGTCATGCAGACGAATAATGAAACCGGTATCCGCCAGCCATTGGATGATA
TTGCCGAAATACTAAAGAATCATCCTGCCTACTTCCACACCGATGCGGCGCAGGGTTTTGGTAAGGATTT
AGAGCTACTACGTAATCTACGGATCGATCTCATCAGTATCAGCGGACATAAAATTTATGCACCAAAGGGA
ATCGGCGCCTTAGTCATGCGGAGGCGTGGCTATGAGCGCATACTACTGCAACCACTCGTCTATGGTGGGG
GGCAGGAGCGTGGCCTGCGGCCGGGAACATTGCCGGTAGCACTGATAGCTGCCCTTGGAACGGCAGCCGA
GATTGCTGTGCGTGATAACGAAAAACGGAGAGAAGCCTGCCGGTGCATGCGGGAAAATGCGTTGAAGGCC
TTATCACCTCTTGAACCGAAATTGACTGGCGAGCAGTCCTTGGCGATGGATCATGTTCTTAACCTGGCCT
TTCCCGGTCTTGATTCTGAAGCCCTGATAGTTGCCCTGAAGGATTTGATTGCGATCTCCAACGGCTCGGC
GTGCACATCGAGTAATTATACACCAAGTCATGTGTTGAAGGCGATGGGTATGAGCGATGACGAAGCGAAT
GCCTGCGTCCGCCTCAGCTGGTGTCATATGACAACGGAGATTGATTGGGATGCCGTGGCTTGTAGAATAT
CTTCGCTGAGATAG