Summary Sequence Context  
1 homologue found:

HomologuedndB
OrganismGeobacter uraniireducens Rf4
GID1018
PID2018
Locus tagGura_2473
Locations2856477..2857553
Length1077 bp
G+C%52.6
Link NCBI: gi:148262085  
SequenceATGGATACGAACTCTACCCTTTCATTCCCAGTTATTCGCGGACTACAGGCCCATCGCGAATATTACGTTG
CCATGTGGACACTCCGGATGATGAGGCAAATTTCGATATTCAATGAAGATGAACTCCCTCCGGAACTACG
CGCCCAGCGAATCCTCAACAAGGCGCGCATACCGGAAATCGCCGAGTATATCATCGACAACCCGGATGAT
TATGTTTTTTCTGCCCTCACCGTTTCAATCGATTCCGACGTCCTGTTTGAGCCGCTCCCCGGCCAGGATA
AACTCGGTCTGCTCCGCGTCCCAATGGATGCCCATTTCATCATCAACGATGGCCAGCACCGCCGGGCCGC
TATTATCGAGGCACTGAAGCAACGACCCGAACTGGAACACGAAACAATCGCCGTAGTCTTTTTCCTAGAC
ATAGGCCTGGAGCGCTGCCAGCAGATGTTTGCCGACCTCAATCGCTACGCCATCCGTCCGAGCCGCTCGC
TGGGCCTGCTGTACGACCACCGCAACGACAAGGCCCGCTTGGCAAAAATGGTTATCATGAAATCGGAAAT
CTTCCGTGACCTGGTGGACATGGAGAAATCCTCTCTCGCCCCCCGCGCCCGAAAACTCTTCACACTCTCC
GCATTTTACAACGCCTGTGCCGATCTTGTTAACGGCTTAGCTACTGGCAATCTGATAGAAGACGCAGATC
TTGCCCGCACATTTTGGGAGGAGACAGCCAAGCATTTCCCTATGTGGGAGCAAGTGCGCGAGGGGAAACT
TCCTGCCAGTGAGGTGAGGGAAGGATTTATCCACTCCCATGGAATTGCGCTCCAGGCCATCGGCAAGGCG
GGAAATGCTCTTCTGCACAGCCATCCAAACGACTGGAAAAAACGACTGAAAGCCCTGGAAAAAATCGATT
GGTCGCGCAACAATGCCAAGATATGGGAAGGCAGAGCCATAATTGGCGGCAAAGTCTCCAAATCCACCAC
TAACGTCGTCCTGGCCACAAATGTCATAAAGAAAGCCTTATCGCTCTCTCTCAGCGAAGAAGAACAGCGA
GTCGAAACAGCACACCTCAAAAAGTAA