Summary Sequence Context  
1 homologue found:

HomologuedndC
OrganismGeobacter uraniireducens Rf4
GID1036
PID2036
Locus tagGura_2474
Locations2857578..2859233
Length1656 bp
G+C%53
Link NCBI: gi:148262085  
SequenceATGAAAACAGCAAAAAAGAAAGCTGGTGTTCCAGCAACAAATGATTCTGTACAACCTGAATGTACGGTAA
CTGAAACATCTCTTCCCAACACAGACAACTCAAATTCGCCAGCTGCAAAGGTCCGCAAATCGGCCTTCAA
TGAACTCGGTTTCCAGGCGACCATCGAGCTGCTTCAGGAAGAAATCCGTAGCCTCTACATTGCCGACGAA
ATCCCCTGGATCATCGGCTATTCCGGCGGCAAGGATTCCACCGCAACCCTCCAACTGGTTTGGACCGCCA
TCGCAGAACTTCCTGCTGAACAGCGCCGGAAAACGGTCTATGCAATCTCCACCGACACCATGGTGGAAAA
TCCGGTCGTAGCTGCATGGGTGGCTAATTCGCTCGCTGTCATGAAGCGAGCTTCTGCCGAGCAACTGGTA
CCCATACAACCTCGCCGCCTGACACCGGCTTTGGTAGATTCTTTCTGGGTCAATTTGATCGGGAAAGGGT
ATCCTGCCCCTCGACACAAATTCCGCTGGTGCACGGCCCGCCTGAAAATTTCACCCTCCAACTCCTTCAT
CAACAGCATCGTATCTTCAAGTGTCGAAGCCATTCTCGTCCTTGGTACTAGAAAGGCAGAGAGCTCAGCC
CGTGCAGCCAACATGGCTCGACATGAAAAGGGACGAGTCCGGGATCGGCTCAGTCCCAATTCCAGCTTAC
CTGGCTCACTCGTCTACTCTCCCATTGAGGCTTGGACAAACGACGATGTCTGGTTTTATCTCATGCAAGT
TAAAAATCCGTGGGGCTACAACAATCGGGATCTGCTTGGCATGTATGCCGGGGCATCTGCTGATGGCGAG
TGTCCGCTCGTCGTAGATGATTCAACGCCGAGTTGCGGTGACTCACGTTTTGGCTGCTGGGTCTGCACCC
TGGTGGACAAAGACAAGTCCATGACCGCCATGATTCAGAATGACGAAGAAAAAGAATGGATGATGCCACT
GCTCGATATCCGCGACGCTCTGGATTTCCGCAGAGACCACAAGGGCGAATACGCTGAAAATGCTGATTAT
GACATCCGCGATTTTCGCCGCATGAGCGGTGCCGTCCAAGTGATGTCGGGTGGCCGCCCAATTCCCGGAC
CCTACATTCAGAGCGCTCGGGAAGAATGGCTTAGGAAGTTGCTCATTGCCCAAACCTACATCCGCAAAAA
CGGCCCACCCGAAGTACAAGGGATAGAACTGATAACCCTGGAAGAGTTACAGGAGATCCGTCGTATCTGG
GTGGTAGACAAGCACGAACTGGAAGACTCTCTGCCCCGCATTTACCGGGAAGCTACCGGCAATGATTACC
CAGGCCGCCCACTAGATGACAATCTGGTGATTGGCGAGGAAGAAATGCACGTTCTTGCCGAACTATGCGG
AGAAGATCGCCTGCACTATGAGCTTACGCGCGAACTATTGAGTATAACCCGGCAACAACGGACAACCTCC
CGTCGTGCCGGTCTTCATGAGCAACTAGAGAAGACCTTTTCCCGCCATTTTTACGACGACAAGCAGGACG
CCCTCACCCGCGCCCAGCAGATGGCCGATCAAAAGCAACGTTTGTCCAATAATCGCCAGCAGTTCGTTTC
GGTCGTCATGGAACCTTTGGCCTGCGATCAGGAGGGCGAAGCATGA