Summary Sequence Context  
1 homologue found:

HomologuedndD
OrganismGeobacter uraniireducens Rf4
GID1054
PID2054
Locus tagGura_2475
Locations2859230..2861206
Length1977 bp
G+C%52.3
Link NCBI: gi:148262085  
SequenceATGATACTGGATACGATCATACTGGAAAACTATGGTGCTTACGGTGGACGGCAGGAAGCTCTCCTTACTC
CTGAAGAGGGGAAGCCTATCATCCTTTTCGGTGGTATGAACGGCGGCGGTAAAACAACCCTGCTCGACGC
TATTCAACTGGCCTTCTATGGGCCAAAGGCGCGTATCTCCAACCGGGGCAAGCTTGGCTATAAGGAGTAC
CTCCGGGAATCGATCCACCGCGGCGGAGATCCGGGCGAAGGGGCCGGCATCACGGTGCGCTTCCGCCGGG
TCATCGAAGGTAAAAGTAGAAATTTCGAATTACAACGTTGCTGGCGTGAAGGGGTTAAAGGAATCGAGGA
AACTGTTAGGGTCCTTCGTGATGGCCTCCCCGATGATATATTCACCGAACATTGGGATGAATCCATCGAA
GCCTATCTCCCCAGCAGTATCGCCCACCTCTTCTTCTTTGACGGCGAACAGATCAAGGAGTTGGCCGAGG
GTGGCCACGCTGCTGATATTCTCGGCACAGCCATCCACTCCCTGCTGGGTCTTGATTTGGTTGATCGCCT
GGAAAACGATCTCAAGGTGTTTGAACGGCGCAAGAAAGCCGAAGGACTCGACCCCGAAGCAACAAGGAAG
CTAGCAATTGCGCGAAGTGAGTTCGTTGAAATCTTCCGGGAGGAGGAAAAGGCCGCTTCGTTGTCGGGTG
CACTCACCAATGAATCAAACCAACTTGCAAAGGAATTGCATGCTAAAGAAGAATTATTCCGGAAGGAAGG
TGGCGATCTTTTTTTACGGCGCAAAGAGCTGGAAGATGAGCTAGTCGCACTGAAGGCCCGGAAAGCAGCA
ACAGAGGCGCAATTCCGAGAGCTGATCGCTGGACCGCTGCCGTTCCTTCTGGTGGAAAACCTGCTTGCCG
AAGTGGAGCAGGTCGTTCGTCATGAAACCGAAATAAAGCGTGCTCGGGTATTGTTGGAGGTATTGGAAAC
CCGCGACACTGAGGTGCTGGACTCCCTGAAAGCGGAAAAGATCGGTGGGCAGCTACTTCGCTCCATGGAC
AGGATTCTGGAAAAAGACCGCAAAAGCAGGGCCGGACTAGCGAAGAAAACATTAATTCTCGACGCAGATG
ACACTCTGGCCCCGCAGATAGCCCATTTGCGTGGGACCGTACTCCCGACAGCCGAACAACAGGCGTGTGA
CTTCACTGCAAAAATTGCTGCCTTGGACGAGAAAATTGCCCGACTGGAAGGTGAACTGGATCGTGCTCCG
ACTGCGGAGCGGATTGCAGAAGTTCAAGAGGTGCTGGAAGCAGCCCGAAAAGCCCATCAGGCTAAACTGG
CTGAACTTGAGGCGATAAAGGTGCGCCGCCAGGCGTTACAGCGGCAACGACTGATGGCGGAAGCCAGGTT
AGACAAGATGGGAGAAAATGATGTTAATTCCCAATTCCATGAGGATGGCCGCCTGCGGATGCTTAAACAC
TCGCTTCGGGTGCGTGAGACTCTTGGGCGATTCCGCACTAAGATCGTAAAACATCACACTGAGAACATGG
AATCGCTGATGCTTGAATCCTTCTGCAAGCTGCTCCGTAAGAAGGAGTTGGTTAGTGGACTAAAGATAAA
TCCTGAGACATTCGAGGCCACGCTTGTAACCAAGGATGGGAAGATCCTCCCCTTTGAACGTCTTTCCGCT
GGCGAAAAGCAACTCCTAGCAACGTCACTTCTCTGGGGTCTTGCTCGCGCTTCCGGACGCCCTGTGCCAA
CAATTATTGACACTCCACTGGGGCGGCTCGACTCTTCACACCGTAAGCATCTGATAGAACGCTACTTCCC
GAATGCCTCCCATCAGGTTCTATTGTTGTCTACAGATGAGGAGATTGTTGGGACTTATTACAAGGAACTG
AAACCCTTCATAACCAGAACCTATCTTCTTGAGCACAACGAGGAGGCGGGGCAAACAAATCTTAAGCAAG
GATACTTCAACGTATGA