Summary Sequence Context  
1 homologue found:

HomologuedndE
OrganismGeobacter uraniireducens Rf4
GID1081
PID2081
Locus tagGura_2476
Locations2861203..2861601
Length399 bp
G+C%40.3
Link NCBI: gi:148262085  
SequenceATGAGACCACCAGTTGAGCATGTGCGAGTTAGCACTAAGGGGAAAGAAATATTAATCAAGATAAAAAGAC
GTACAGGTCTAGAGCATTGGAACGAAGTATGTAGAGTGGCACTTTGCCATTCGCTTTCAAATCCAACATC
GCCTCCGAAGCTTGAAAGAGTCAGTGACAGCACAATCGATATTGAATGGAAAACGTTCGCAGGACAGTAT
CAAAAAGAATTTGCTGCTATGATCATGCTTAGGAGCAAGCAACATGGCATAAATATAAACGATAGAGAGG
AAATAGCTCAATATTTTCGATCTCACCTAGAGAGAGGAATCGTGTCCTTGCAGACTAGCAAAGATGTTAG
CAGCTTGTTCCATTATTCTCAGCATTTTGAGTTGAAAGATAATCCATGA