Summary Sequence Alignment 16S rRNA Context  
5 homologues found:

HomologuedndA
OrganismCandidatus Pelagibacter ubique HTCC1002
GID1006
PID2006
Locus tagPU1002_00495
Locations71910..73046
Length1137 bp
G+C%29
Link NCBI: gi:91762995  
SequenceATGAGTATTTATTTAGATTGCAATGCAACATCCCCGATTGAACCTGAGGTTGTAGAAAAACTTACCCAAT
ATTTAACAATAGATTTTGGCAATGAGGGATCACACACACATGAGTTTGGATCTACTGCAAAAAAAGCTGT
TCAAGAGGCAAGAGATAATATTGTGAGCTTAGTAGATGCCTCAAGAAATGAAATAATTTTTACATCTGGT
GCAACTGAAAGTAACAATATTGCAATCCTTGGACTAAAAGAGTTTGGAATTAAGAATAATAAAAAACATA
TTATAACATCTACTATAGAGCATAAGGCTGTATTAGAACCTATTGAAGAATTAAAAAAATTAGGCTTTGA
AGTAGATGTCTTACCTGTAGATAAATCAGGAAGAGTTAATCCTAAAGATATTCAAAAAAAACTTAAAGAA
GAAACATTGTTAGTTTCTATTATGCATGTGAATAATGAAACTGGTATCATTCAGCCTATTGAAGAAATTT
GTAAAGTAATTGAAAATAATGATTGTTTCTTTCATGTAGATGGAGCTCAAGGCTTTGGTAAAGAAATAGA
TACATTAAAAAATAAAAGAATAGATTTAATAAGTATTAGTGGTCATAAAATATATGGACCAAAAGGTATT
GGTGCTCTTATAACAAGACTTAGAAACTATAACAAACCTCCTTTACAACCTTTATTCTTTGGTGGTGGCC
AAGAATCTAAATTAAGACCTGGAACTCTACCTGTTCATTTAATAGCAGGTTTGGGTGTTGCTGCTAAAGT
TGCAAAGAGAGATTTAAAAAAAAGACAGACAAAAAATAAGGTAATTTTTGATAAAATTATGGATTTGATA
AAAAATTTAAAAGGTGAATTAAATGGAGATACAAAACATTTACTTGGTAATTGTATAAATTTTTCAATAC
CTGGGGTTGATGCTGAAGCTTTTATGTTAATGACAAAAGAATTAATCTCTATTTCAAATGGGTCTGCGTG
TACTTCATCTACTTATGAACCTTCTCATGTTATTAAATCAATGACTAATAATGAGGATAAAATAAGGGGT
GCATTACGTTTTTCATGGTGTCATTTAACAGATAATAAAATTCCTGTTGAAGAAATTGAAAAAAAATTAC
AAAATATTCTTTATTAA

HomologuedndB
OrganismCandidatus Pelagibacter ubique HTCC1002
GID1019
PID2019
Locus tagPU1002_00500
Locations73129..74214
Length1086 bp
G+C%31
Link NCBI: gi:91762995  
SequenceATGAGTTTAAATGTCCACAAATTTGCAGCAATCAAAGGAAGACAATCTGGTGATGATTATTTTACCGTTG
TTTGTGAAATGTCAATTATACCAAGATTGTTTTTATTTAATGAAGCAACTATTCCAACAGAACTTAGAGC
TCAAAGACATATAAATAAAACTCGTATTCCAGAGATGGCAAGATACATGGTGGATAACCCAAAAAACTAT
ATTTTTTCAGCCTTAACAGCTTCAATTGATGGCAATATAAGCTTCAAGCCCCTTAAACTTAACGGCAAAG
ACAGTGAAATTGGTGAACTAGAAATAGCAGGGGATGCAAAACTAATGATTAATGATGGACAGCATAGAAG
AGCAGCGATTGAAAAAGCATTAACTGAAAATCCAGATTTAGCGAATGATACAATTTCAGTAGTATTTTTT
AAAGACAAGGGTTTAAAAAAATCTCAACAGATGTTTTCTGATTTAAACCGTCATGCAATAAGACCTGCAA
CATCTATTGCAAGATTGTATGATCACCGAGACCCTATTGCAGAGGTTATTCGAAGAGTAGTTTATGAAAC
TGAAGTATTTAAAGGTGTAGTTGAAATGGAACGATCGAATATTGCAGAGAGATCATCAAAATTATTCCCT
TTCTCAGGAATTTATTCTGCATCTAAATATTTAATTAATTTAGAGGATAAGAAAAAAATTGAACAGATTG
TTACTTTAGTGAGTTCTTTTTGGGATAATGTTGGGCAACAATTTGATCAGTGGCGTGGTGTTAGAATTGG
CAATATTTCAGCAACAGAAGTTAGAAGGGATTATATTCATACTCATGTAGTCATGTTACAAGCCTTAGGT
ATTGCTGGTAAAGATTTAATTAAAGCAAACCCTACTAATTGGAAAGCAAAATTAAAAAATTTAAAGAAAA
TTGATTGGTTAAAAAGTAATCCTATTTGGGATCGACGTGTATTAAATAATGGAAGAGTGGTTAAAAATTC
AAATAGTATAGTTTTAGCATCAAATGTAATTAAAAAAGCTTTCGGAGTTACGTTAAACGTAAATGAAAAA
GCATTAGAAAGTAAATTTAAAAAAAATGGAAAATAA

HomologuedndC
OrganismCandidatus Pelagibacter ubique HTCC1002
GID1037
PID2037
Locus tagPU1002_00505
Locations74204..75688
Length1485 bp
G+C%31
Link NCBI: gi:91762995  
SequenceATGGAAAATAAAAAGAAATCTTTTTTTGATGAAGTGGGTTTTAAACCAACAATTACAAAATTAGTTGATC
TAATTGCAAAATTGTATTTAGAGGATGAGAACCCTTGGGTAGTAGGTTATTCTGGTGGAAAAGATAGTTC
TGCTTGTCTACAATTAATGTGGAGAGTTTTAGAAAAAATTAAATCAGAAAATAAAGTTATTAAACCTCTT
TATGTAATCACTACAGACACATTGGTTGAAAACCCAATTGTTGCAACATGGGTTAAATCTTCACTTGATT
TGTTAAGAGACAAAGCCAAAGATAATGGACTGCCCATTTTTCCATCATTATTAACTCCTAATATAGAAGA
AACTTTCTGGGTTAATTTAATTGGTAAAGGTTATCCAGCACCTAATACAAAGTTTAGATGGTGTACGGAA
CGGATGAAAATTAGACCAAGTGATAGATTTTTAAGAAAATTATCTAATGAAAGTGGTGAAGCAGTAATAG
TATTAGGAACTCGTAAAGCAGAAAGCTCTAATAGGGCTCAATCTATTTCTAGATTTGAAAAAGAGGCAAC
ACGACAAAATTTTCAACCTCATGTAAATTTATCAAATGTTTCTTCATTTCTACCAATTAAAGATTGGACT
AACGATGATGTTTGGCTGTATCTGCTTCAAGACCAGTCTCCATGGGGTATAAATAATAAAGATCTTTTAA
CTATGTATCAGGGAGCAACTGATGGAGGTGAATGCCCATTAGTTGTTGATACATCTACCCCATCTTGTGG
GGATAGTCGATTTGGTTGTTGGGTTTGTACACTCGTTAAACAAGATAAATCAATGTCTGCAATGGTTCAA
AACGATTCAGAGAAATCATGGATGGAACCCTTACTGCAATTAAGAAATGATTTAACTGAAAAAGATTTTG
AAAAAAGAGACTTTAGAAGATTAACAGGTCATGTGCAGTTAATGCCTAATGATGATGAACGAACGGTTCC
TGGACCTTATACTAAAAGTACTAGAAAAAATTGGTTAGAAAGATTATTACAAGCACAAAATAAAATAAGA
CAAAATAAAAAACTACCTGAAGAACTTAAAAAGATAAAATTGATAACTCAAGAAGAGTTAGATCAAATAA
GAAAAATTTGGTTTTATGAAAAGTTAGAAACAGATGATGTCTTACCTTCTATTTGTGAAAAAGAAGCTAA
GGGTGAGTATCACTTTGAAGCATTAGAAGACAGTCACGTATTTAATCATGAAATATTACAACTTTTAAAA
GATACCTGTGGTGATGATGAAATGATTTTTGAAATTGCAAGAGGTTTATTAGAAGTTGAACGAAAACATT
TCAAGAGTAATAGACGAACAGGTTTATTTGATGAATTCGAAAATATTTTCAAAAAATCTTTTTACAAAGA
TAAAACAGATGCAATTGAATACGCAAAAGAAAAAAGAAAAATTAAATCTCAAGGTGAAAAACAATTACCC
TTAATAAATAATTAA

HomologuedndD
OrganismCandidatus Pelagibacter ubique HTCC1002
GID1055
PID2055
Locus tagPU1002_00510
Locations75688..77652
Length1965 bp
G+C%26
Link NCBI: gi:91762995  
SequenceATGATTTTCGAAAATTTACTTATTAATAATTTTGGTGTCTATAGTGGTAAGCAAAATTTTGACCTATCTA
CTAAAGAAAAAAAACCAGTTATCTTAATTGGTGCTTTAAATGGAAGTGGTAAAACAACTTTTTTACAAGC
AATTGACTTTGTCTTATACGGAAAGTTTTCTAACTTTTTCTATTCACAAAAATTATCATATGAAAATTTC
TTAAAAAAGAATATTAATAAAAATAATTATGATGAGGGTGCACAAGTTGAATTGGTATTTTATAGAAAAT
ACAAAGGTAAAGATGAAAAATTTAAAATTTCAAGAAATTGGAAAGCTATTGGAAAAAAGATAAAGGAAGA
ATTTTTTGTATTTATTGATGATGTCTACGATGAAGATATCACTAAAGATTGGGATAACTTTGTTGATCAA
ATCTTACCTTCTAGAGTTGCTTCATTATTCTTCTTTGATGGTGAAAAAATTGAACAACTAGCAGATCTTG
AGCAGTCCAAGGGCGTACTAAAGAAAGCAATTAATTCGTTATTAGGTTTGGAAATAGTAGATCAGTTAAA
TATTGATGTAGATGAGTTTCAAAAACGATCAGTGTTGCAATTAAAAACAGATGATGAGAAAAAAAATATA
AATAAACTCAAAAAAGAAGTGGATGAATTTGAGGATAGAATAAAGGAAATTGATAAAAGCATCGTTAAGG
TAGAGGACGAATTAGCGAAAAAGGCCTATGATATAAGGGAATTAAACGTTGTATTGTCTCAAAAAGGAAT
TTCATATTATGAAAAAAAACAAGAATATGAAAAAGAATTACAGGTTATAGACGAAAAGCGAACCGAAATT
AGTGATGAACTAGTTAAACTAGCATCAGGAGACTTACCATTATTAGTTGTTAAGAATGAGTTAGCCACAA
TGGTAGACCAAAGTAAATCACTACTTGAAAATCAAAACAAGACAGATAGTCAAAAAAAAAATAATGATTT
AATTGAAAGTATTAGCTCTTTTGTCCTTAAGAATTCAAAAGATGATAAATTTACTAAAAATTTTGAAAAG
TTTGTAAGTGATAAAAAGATTAATGACACTACAATTTTAGATAATGAAAATTTATTACCTAATTTAAATT
ATCAAGATCTTAATTCATTATTAAATCACAATTTAGATACTGCTGAAAAAGATATTAAGAAAAAAATAAA
TACTATTAATAAGTTAGAAGAGGAATACGAAAAAATTTCACAACTAATTAATAAAATACCAACTGATGAT
GAAATTAAACCTTTAATTGACAAACTAGAAGAACACCAAAAAGATGAGGCTAAACTAATAACTAAAAAAA
ATATTCTTGATGAACAACGAGGTCAAATTAATGGACCTTTAATAAAAATTAATATTGAACTTAAAAAAGA
ATATGAAAAAAAAACAACACAAGATTTGGTTAATTTAGATAAAAAAAGATTTGTTGATTATTCAGTTAGA
ATAAAAGATGTCTTAAGTACTTTTCATGTTAAGGCATTAGATTTTCATATTAAAAGATTAGAAAAATTAA
TATTAGAATGCTTTAAAAGGTTACATAGAAAAAAAGATTTTATAAAATCAATCAAAATAGATACCAGTAC
TTTCGACCTTCAAATATTTGAAGCTAAGAATGTCCAAGTTGATACAGATATATTATCAGCAGGGGAGAGA
CAATTACTTGCTGTTGCAATTTTATGGGGATTAGCTAAAGCCTCTAGTAGTGCAGCCCCAACTGTAATTG
ATACACCTTTAGGTAGATTAGATTCAGAACACCGTTTAAATTTAGTAGAACAATATTTTCCAACAGCTTC
AAAACAAGTTATTTTATTATCAACTGATGAAGAGATTAATCAAAAATATCACAAATATATGAAACCTTAC
TTAGCAAGGTCATATAAAATTGAATATGATGAAAAAATTAATGGTAGTAAATCAACTTTAGGATACTTTT
TTTAA

HomologuedndE
OrganismCandidatus Pelagibacter ubique HTCC1002
GID1071
PID2071
Locus tagPU1002_00515
Locations77652..78035
Length384 bp
G+C%30
Link NCBI: gi:91762995  
SequenceATGGACTTTTATATTGATCAATTAAGAACCTCTACGCATCTAAAAAATATATTAACTAGAGTTAGATCAA
GAACGGGTATTCAAAACATGAATGTCATTTGTAGATGGGGATTTTGTCTTTCATTAAAACAGACCTCTTT
ACCAAGAGATATTGATGAAAAACTAGATGGTGTCACAATTGATTATGATACTTTTGCTGGTAAAAATAAG
ATTATCTACACCCAACTATTAGTAAACAATATGGTCAAACATAATGTAGAAATTACACGAAGAAGTCTGG
CAAAATACCTAAATTCACACGTAAATAGGGGAATTAACATCATTTATAATAATAAGTTAAAAAGCATTGT
TGGCCTCTTAAAACTTACGAACTCAAAAAGCTAA