Summary Sequence Context  
1 homologue found:

HomologuedndA
OrganismCandidatus Pelagibacter ubique HTCC1002
GID1006
PID2006
Locus tagPU1002_00495
Locations71910..73046
Length1137 bp
G+C%29
Link NCBI: gi:91762995  
SequenceATGAGTATTTATTTAGATTGCAATGCAACATCCCCGATTGAACCTGAGGTTGTAGAAAAACTTACCCAAT
ATTTAACAATAGATTTTGGCAATGAGGGATCACACACACATGAGTTTGGATCTACTGCAAAAAAAGCTGT
TCAAGAGGCAAGAGATAATATTGTGAGCTTAGTAGATGCCTCAAGAAATGAAATAATTTTTACATCTGGT
GCAACTGAAAGTAACAATATTGCAATCCTTGGACTAAAAGAGTTTGGAATTAAGAATAATAAAAAACATA
TTATAACATCTACTATAGAGCATAAGGCTGTATTAGAACCTATTGAAGAATTAAAAAAATTAGGCTTTGA
AGTAGATGTCTTACCTGTAGATAAATCAGGAAGAGTTAATCCTAAAGATATTCAAAAAAAACTTAAAGAA
GAAACATTGTTAGTTTCTATTATGCATGTGAATAATGAAACTGGTATCATTCAGCCTATTGAAGAAATTT
GTAAAGTAATTGAAAATAATGATTGTTTCTTTCATGTAGATGGAGCTCAAGGCTTTGGTAAAGAAATAGA
TACATTAAAAAATAAAAGAATAGATTTAATAAGTATTAGTGGTCATAAAATATATGGACCAAAAGGTATT
GGTGCTCTTATAACAAGACTTAGAAACTATAACAAACCTCCTTTACAACCTTTATTCTTTGGTGGTGGCC
AAGAATCTAAATTAAGACCTGGAACTCTACCTGTTCATTTAATAGCAGGTTTGGGTGTTGCTGCTAAAGT
TGCAAAGAGAGATTTAAAAAAAAGACAGACAAAAAATAAGGTAATTTTTGATAAAATTATGGATTTGATA
AAAAATTTAAAAGGTGAATTAAATGGAGATACAAAACATTTACTTGGTAATTGTATAAATTTTTCAATAC
CTGGGGTTGATGCTGAAGCTTTTATGTTAATGACAAAAGAATTAATCTCTATTTCAAATGGGTCTGCGTG
TACTTCATCTACTTATGAACCTTCTCATGTTATTAAATCAATGACTAATAATGAGGATAAAATAAGGGGT
GCATTACGTTTTTCATGGTGTCATTTAACAGATAATAAAATTCCTGTTGAAGAAATTGAAAAAAAATTAC
AAAATATTCTTTATTAA