Summary Sequence Context  
1 homologue found:

HomologuedndB
OrganismCandidatus Pelagibacter ubique HTCC1002
GID1019
PID2019
Locus tagPU1002_00500
Locations73129..74214
Length1086 bp
G+C%31
Link NCBI: gi:91762995  
SequenceATGAGTTTAAATGTCCACAAATTTGCAGCAATCAAAGGAAGACAATCTGGTGATGATTATTTTACCGTTG
TTTGTGAAATGTCAATTATACCAAGATTGTTTTTATTTAATGAAGCAACTATTCCAACAGAACTTAGAGC
TCAAAGACATATAAATAAAACTCGTATTCCAGAGATGGCAAGATACATGGTGGATAACCCAAAAAACTAT
ATTTTTTCAGCCTTAACAGCTTCAATTGATGGCAATATAAGCTTCAAGCCCCTTAAACTTAACGGCAAAG
ACAGTGAAATTGGTGAACTAGAAATAGCAGGGGATGCAAAACTAATGATTAATGATGGACAGCATAGAAG
AGCAGCGATTGAAAAAGCATTAACTGAAAATCCAGATTTAGCGAATGATACAATTTCAGTAGTATTTTTT
AAAGACAAGGGTTTAAAAAAATCTCAACAGATGTTTTCTGATTTAAACCGTCATGCAATAAGACCTGCAA
CATCTATTGCAAGATTGTATGATCACCGAGACCCTATTGCAGAGGTTATTCGAAGAGTAGTTTATGAAAC
TGAAGTATTTAAAGGTGTAGTTGAAATGGAACGATCGAATATTGCAGAGAGATCATCAAAATTATTCCCT
TTCTCAGGAATTTATTCTGCATCTAAATATTTAATTAATTTAGAGGATAAGAAAAAAATTGAACAGATTG
TTACTTTAGTGAGTTCTTTTTGGGATAATGTTGGGCAACAATTTGATCAGTGGCGTGGTGTTAGAATTGG
CAATATTTCAGCAACAGAAGTTAGAAGGGATTATATTCATACTCATGTAGTCATGTTACAAGCCTTAGGT
ATTGCTGGTAAAGATTTAATTAAAGCAAACCCTACTAATTGGAAAGCAAAATTAAAAAATTTAAAGAAAA
TTGATTGGTTAAAAAGTAATCCTATTTGGGATCGACGTGTATTAAATAATGGAAGAGTGGTTAAAAATTC
AAATAGTATAGTTTTAGCATCAAATGTAATTAAAAAAGCTTTCGGAGTTACGTTAAACGTAAATGAAAAA
GCATTAGAAAGTAAATTTAAAAAAAATGGAAAATAA