Summary Sequence Context  
1 homologue found:

HomologuedndC
OrganismCandidatus Pelagibacter ubique HTCC1002
GID1037
PID2037
Locus tagPU1002_00505
Locations74204..75688
Length1485 bp
G+C%31
Link NCBI: gi:91762995  
SequenceATGGAAAATAAAAAGAAATCTTTTTTTGATGAAGTGGGTTTTAAACCAACAATTACAAAATTAGTTGATC
TAATTGCAAAATTGTATTTAGAGGATGAGAACCCTTGGGTAGTAGGTTATTCTGGTGGAAAAGATAGTTC
TGCTTGTCTACAATTAATGTGGAGAGTTTTAGAAAAAATTAAATCAGAAAATAAAGTTATTAAACCTCTT
TATGTAATCACTACAGACACATTGGTTGAAAACCCAATTGTTGCAACATGGGTTAAATCTTCACTTGATT
TGTTAAGAGACAAAGCCAAAGATAATGGACTGCCCATTTTTCCATCATTATTAACTCCTAATATAGAAGA
AACTTTCTGGGTTAATTTAATTGGTAAAGGTTATCCAGCACCTAATACAAAGTTTAGATGGTGTACGGAA
CGGATGAAAATTAGACCAAGTGATAGATTTTTAAGAAAATTATCTAATGAAAGTGGTGAAGCAGTAATAG
TATTAGGAACTCGTAAAGCAGAAAGCTCTAATAGGGCTCAATCTATTTCTAGATTTGAAAAAGAGGCAAC
ACGACAAAATTTTCAACCTCATGTAAATTTATCAAATGTTTCTTCATTTCTACCAATTAAAGATTGGACT
AACGATGATGTTTGGCTGTATCTGCTTCAAGACCAGTCTCCATGGGGTATAAATAATAAAGATCTTTTAA
CTATGTATCAGGGAGCAACTGATGGAGGTGAATGCCCATTAGTTGTTGATACATCTACCCCATCTTGTGG
GGATAGTCGATTTGGTTGTTGGGTTTGTACACTCGTTAAACAAGATAAATCAATGTCTGCAATGGTTCAA
AACGATTCAGAGAAATCATGGATGGAACCCTTACTGCAATTAAGAAATGATTTAACTGAAAAAGATTTTG
AAAAAAGAGACTTTAGAAGATTAACAGGTCATGTGCAGTTAATGCCTAATGATGATGAACGAACGGTTCC
TGGACCTTATACTAAAAGTACTAGAAAAAATTGGTTAGAAAGATTATTACAAGCACAAAATAAAATAAGA
CAAAATAAAAAACTACCTGAAGAACTTAAAAAGATAAAATTGATAACTCAAGAAGAGTTAGATCAAATAA
GAAAAATTTGGTTTTATGAAAAGTTAGAAACAGATGATGTCTTACCTTCTATTTGTGAAAAAGAAGCTAA
GGGTGAGTATCACTTTGAAGCATTAGAAGACAGTCACGTATTTAATCATGAAATATTACAACTTTTAAAA
GATACCTGTGGTGATGATGAAATGATTTTTGAAATTGCAAGAGGTTTATTAGAAGTTGAACGAAAACATT
TCAAGAGTAATAGACGAACAGGTTTATTTGATGAATTCGAAAATATTTTCAAAAAATCTTTTTACAAAGA
TAAAACAGATGCAATTGAATACGCAAAAGAAAAAAGAAAAATTAAATCTCAAGGTGAAAAACAATTACCC
TTAATAAATAATTAA