Summary Sequence Context  
1 homologue found:

HomologuedndD
OrganismCandidatus Pelagibacter ubique HTCC1002
GID1055
PID2055
Locus tagPU1002_00510
Locations75688..77652
Length1965 bp
G+C%26
Link NCBI: gi:91762995  
SequenceATGATTTTCGAAAATTTACTTATTAATAATTTTGGTGTCTATAGTGGTAAGCAAAATTTTGACCTATCTA
CTAAAGAAAAAAAACCAGTTATCTTAATTGGTGCTTTAAATGGAAGTGGTAAAACAACTTTTTTACAAGC
AATTGACTTTGTCTTATACGGAAAGTTTTCTAACTTTTTCTATTCACAAAAATTATCATATGAAAATTTC
TTAAAAAAGAATATTAATAAAAATAATTATGATGAGGGTGCACAAGTTGAATTGGTATTTTATAGAAAAT
ACAAAGGTAAAGATGAAAAATTTAAAATTTCAAGAAATTGGAAAGCTATTGGAAAAAAGATAAAGGAAGA
ATTTTTTGTATTTATTGATGATGTCTACGATGAAGATATCACTAAAGATTGGGATAACTTTGTTGATCAA
ATCTTACCTTCTAGAGTTGCTTCATTATTCTTCTTTGATGGTGAAAAAATTGAACAACTAGCAGATCTTG
AGCAGTCCAAGGGCGTACTAAAGAAAGCAATTAATTCGTTATTAGGTTTGGAAATAGTAGATCAGTTAAA
TATTGATGTAGATGAGTTTCAAAAACGATCAGTGTTGCAATTAAAAACAGATGATGAGAAAAAAAATATA
AATAAACTCAAAAAAGAAGTGGATGAATTTGAGGATAGAATAAAGGAAATTGATAAAAGCATCGTTAAGG
TAGAGGACGAATTAGCGAAAAAGGCCTATGATATAAGGGAATTAAACGTTGTATTGTCTCAAAAAGGAAT
TTCATATTATGAAAAAAAACAAGAATATGAAAAAGAATTACAGGTTATAGACGAAAAGCGAACCGAAATT
AGTGATGAACTAGTTAAACTAGCATCAGGAGACTTACCATTATTAGTTGTTAAGAATGAGTTAGCCACAA
TGGTAGACCAAAGTAAATCACTACTTGAAAATCAAAACAAGACAGATAGTCAAAAAAAAAATAATGATTT
AATTGAAAGTATTAGCTCTTTTGTCCTTAAGAATTCAAAAGATGATAAATTTACTAAAAATTTTGAAAAG
TTTGTAAGTGATAAAAAGATTAATGACACTACAATTTTAGATAATGAAAATTTATTACCTAATTTAAATT
ATCAAGATCTTAATTCATTATTAAATCACAATTTAGATACTGCTGAAAAAGATATTAAGAAAAAAATAAA
TACTATTAATAAGTTAGAAGAGGAATACGAAAAAATTTCACAACTAATTAATAAAATACCAACTGATGAT
GAAATTAAACCTTTAATTGACAAACTAGAAGAACACCAAAAAGATGAGGCTAAACTAATAACTAAAAAAA
ATATTCTTGATGAACAACGAGGTCAAATTAATGGACCTTTAATAAAAATTAATATTGAACTTAAAAAAGA
ATATGAAAAAAAAACAACACAAGATTTGGTTAATTTAGATAAAAAAAGATTTGTTGATTATTCAGTTAGA
ATAAAAGATGTCTTAAGTACTTTTCATGTTAAGGCATTAGATTTTCATATTAAAAGATTAGAAAAATTAA
TATTAGAATGCTTTAAAAGGTTACATAGAAAAAAAGATTTTATAAAATCAATCAAAATAGATACCAGTAC
TTTCGACCTTCAAATATTTGAAGCTAAGAATGTCCAAGTTGATACAGATATATTATCAGCAGGGGAGAGA
CAATTACTTGCTGTTGCAATTTTATGGGGATTAGCTAAAGCCTCTAGTAGTGCAGCCCCAACTGTAATTG
ATACACCTTTAGGTAGATTAGATTCAGAACACCGTTTAAATTTAGTAGAACAATATTTTCCAACAGCTTC
AAAACAAGTTATTTTATTATCAACTGATGAAGAGATTAATCAAAAATATCACAAATATATGAAACCTTAC
TTAGCAAGGTCATATAAAATTGAATATGATGAAAAAATTAATGGTAGTAAATCAACTTTAGGATACTTTT
TTTAA