Summary Sequence Context  
1 homologue found:

HomologuedndE
OrganismCandidatus Pelagibacter ubique HTCC1002
GID1071
PID2071
Locus tagPU1002_00515
Locations77652..78035
Length384 bp
G+C%30
Link NCBI: gi:91762995  
SequenceATGGACTTTTATATTGATCAATTAAGAACCTCTACGCATCTAAAAAATATATTAACTAGAGTTAGATCAA
GAACGGGTATTCAAAACATGAATGTCATTTGTAGATGGGGATTTTGTCTTTCATTAAAACAGACCTCTTT
ACCAAGAGATATTGATGAAAAACTAGATGGTGTCACAATTGATTATGATACTTTTGCTGGTAAAAATAAG
ATTATCTACACCCAACTATTAGTAAACAATATGGTCAAACATAATGTAGAAATTACACGAAGAAGTCTGG
CAAAATACCTAAATTCACACGTAAATAGGGGAATTAACATCATTTATAATAATAAGTTAAAAAGCATTGT
TGGCCTCTTAAAACTTACGAACTCAAAAAGCTAA