Summary Sequence Alignment 16S rRNA Context  
5 homologues found:

HomologuedndA
OrganismRoseobacter denitrificans OCh 114
GID1007
PID2007
Locus tagRD1_0802
Locations779429..780592
Length1164 bp
G+C%55
Link NCBI: gi:110677421  
SequenceATGTCGGCACCGATTTACCTTGACCACAACGCTTCTACTCCGATTGATCCGGAAGTTTTGGAGACGGTCA
TACGTGTCAGTCGGGACGTATATGCGAACCCATCAAGTGTTGAGCATAGCCAAGGTTCAGGGGCTGCTCG
GGTTGTCGATACTGCGCGCGCGCAGATTGCGGGCCATCTCAATTGCAAGGAAACCGAGCTCGTCTTTACA
GCCGGGTCCACGGAAGCCAACAATCTTGCGATCCTTGGAGCGTTCCCTCGGCTCAAGGAGGCGGGGCGCA
CACATCTGATCACCAGCAAGATCGAGCACCCATCTGTTCTGGCCTGTTTCGACCATCTCGAATCCCAAGG
CGCACGGGTAACGCGATTGGGGGTAGATGAAGGTGGCCAGATTTCCCTCGATGAGCTGGCCCTGTCTTTG
ACGGATGAGACCGGATTCTTGTCCATCATGGCTGCCAACAATGAGACGGGCGTTTTGCAACCCATCTTGG
AAGCAGGCCAGCTTGCCGAAGAGGCTGGGGCGCTATTTCACACGGACTTCTCGCAAGCTTCGGCTTTTGT
GCCACTTGATCTCAAGAACGCGCCCATCCATCTGGCGAGTTTCTCTGGCCACAAGGCCTATGGCCCGAAA
GGGGTTGGGGCCCTTTACCGGTCGATCCGAAAACCGCGGGTCAACCTAGCCCCAGTGATGTTTGGTGGCG
GGCAGGAGAAGGGTTTGAGGGCAGGGACCCTGAACACGCCTGGCATTGCCGGCCTTGGACATGCATTTGA
GCTCATCTCAAAAAACATAGACCATGACCGGGATCGGATTGGGGCCCTGCGAGATCAGCTTGAAATCGAA
CTCAAAGAGACCTTAGCGGCGCAGGTCAATGGAAACACTGCAGCGAGGTTGCCAAACACGATGTCCCTCA
CGATCGACGGAGTTGTCCCACAAGCGCTGATGCAAAAGCTAAGAAACGACGTCTGCTTTTCTGCATCGAG
CGCCTGCGCCACAGAACATGTCGAAACCTCTCACGTTCTGCTCGCCATGTTCGGCGACACTCCAAGGGCG
CGAAATGCTTTCCGACTAGGTCTAGGCCGGCAAACCAGCAAAAAAGACATATCCAAAGTCATCAGACTCT
TTTTACAAGCCTCATCAGAACTCCTGCTTCTAAAAACAGCTTAG

HomologuedndB
OrganismRoseobacter denitrificans OCh 114
GID1020
PID2020
Locus tagRD1_0798
Locations774545..775651
Length1107 bp
G+C%54
Link NCBI: gi:110677421  
SequenceATGAGCGGTAACTTCTATAATTTTGCAGCCATACGCGGCGTCCAGGCTGGAACCGAGTATTATGTGATCA
TGGTCCCTCTTAAGATGGTTCCAAAGATTTTCGAATTCGACAGTCAGGAATTGCCAGCAGACCTGCGCGC
TCAACGCGTATTGTCAAATGTCCGCGTTCCGCAAATCGCATCCTACCTCTCGGAAAACTTCGAAGAATAT
ACGCTCTCATCTCTCTGCGCATCTGTGGATGGTGATCTTGAGTTTTCCCCAGCCAGCGACGGTCTTCAGT
TCCGTAATGTAGGCGAGCTACGGCTTTCGATGACAGCCCGCATCATCCTAAACGACGGTCAGCATCGTCG
CGCCGCAATCGAAGAAGCCCTCAAGACGCGACCCAAGCTCGAAAACGAAACCATCTCGGTTGTGCTTTTC
CTCGATGAGGGGCTGGAGCGCTGCCAGCAAATGTTCGCAGACCTCAACAAGAATGCCGTACGCCCATCCG
GGTCGTTGAACGTCCTCTATGACCGCAGAAATCCTTTGGCACGTCTGAGCACGCGCGTGTTAGAGGACAT
TCCGTTTTTCCAAGAATTCACCGAGCTCGAAAAAACATCTCTTTCGAACCGGGCCAAAAACCTCTTTACC
TTGTCCAGCCTGAATCAAGCCAACAAGTGGCTCGCTGGGCAAGATGCGGATCGGTTCGGTGAAAACACTG
AAAGCACCGTGATCGCATATTGGCGTCAGGTTTCTGAGGTCATCCCAGACTGGCAGAAACTGATGCGTGG
CGCGACGACAGCAGGCGACCTGCGAAAAGAAACGGTTCATGCGCATGGCGTGATGCTGCAGGCTTTTGGA
GTCTTAGGGGCAAGACTGATTACAGCAAAGCCGGATGGATGGGCCGAAACCCTGGCTCCGCTCGCGGAGA
TCAATTGGAGCAAGCGCAATGCCCAGCTCTGGCGTCCTCGCGTCATGGGCGCGCGCGGAATGGATGGCAG
TGTGAAATCTGTACATCTGGCGGCCAACGTCCTAGTTGCGGCTGTAGGCTTGCCGCTCAATGAAAAAGAA
CAAGCGAATGAAGACGACTACCTGGCGTCATTGGCTGAGGAGAAAGTCGTCGCATGA

HomologuedndC
OrganismRoseobacter denitrificans OCh 114
GID1038
PID2038
Locus tagRD1_0799
Locations775648..777111
Length1464 bp
G+C%56
Link NCBI: gi:110677421  
SequenceATGACATCAAAGAATGAAACCGACCAAACAAAGCGGGCAGGGCTCGATCTTGTCGCTCTGCAGGAAAATA
TCCGCGCGGTTTACGCGGCAGACGACCGGCCATGGGTGATCGGGTATAGCGGCGGAAAGGATTCAACCTG
TGCCTTGCAGCTAATCTGGAGTGCCATTCGTGCGCTTCCGGAAGACGCGAGACGCAAGCCAATCTTCGTC
CTCAGTTCCGACACGCTTGTCGAAACGCCCGTGATCGTAAACTACATCGACGATACCTTGGCAGCCATCA
ACGCGGCAGCGGCAGACCAGAACATGCCCATCACCGCACAAAAGGTGGTTCCGGAGATTTCAGATAGCTT
CTGGGTGAACCTGATTGGCCGCGGATATCCTGCACCGTCAAAGCGCTTTCGCTGGTGCACGGAGCGGCTG
AAGATCGATCCGGCCAATGCCTTCATCAAGAACCGCGTTGCCGAATATGGCGAGGTGGTCATGGTTCTGG
GCGTACGGTCCTCGGAAAGCGCGACACGCGCGCAGGTGATGTCGCTGCACAAGATCGATGGTACGGCTTT
GTCTCGCCATTCGACCTTACCCGGCGCTTTCGTCTTCACGCCGATCGAGACCTTCAGTGTGGATGATGTT
TGGGCTTTCTTGCTGCAAAATCAGTCACCTTGGGGATCGGACAACCGCGATTTGCTTGCGATGTATCGAA
ACGCGCAAGCTGGCGAGTGCCCACTTGTAGTCGATAAGCAAACTGAAAGCTGCGGGAATTCCCGCTTTGG
CTGCTGGGTGTGCACGGTTGTGACAAAGGACAAGGCCATGGAAGCGCTTGTTGAGAATGGCGAGGAATGG
CTTGAGCCTTTGCTTGATCTCCGTGACGAGCTGGCTGAAACACAAAACCCCGAGCGGAAACGAGAGTTTC
GAGATTTTCGCAGACGGGACGGCTCTGTGACCTTTGTGGGCGATGCAGAGACATCCATTCCGGGGCCCTA
TCTTTTCGAATACCGCAAAGAGCTCTTGAGAAAACTTCTGGAGGCGCAAGAGCGGGTAAATGCCAATGCG
CCACCCGGCGAGAAGACCGACCTTATTCAGGTCGAAGAACTCCGGGAAATCCGTCGGATCTGGCGGAGCG
AACAGGGTGACTGGGGCGACGCTGTTTCAGAGACCCTCAAAGCTGTGACGGGCAAGGAACTCCCAGCCGA
TGCGACCGACGGATTTGAATTCCAAGCCGATGACGCCAAGGTCTTGGCGGATGTCTGCGCCGCGCATGAC
TTGCCGTCACGTCTCTTGGCCCAGCTCCTGGAAGCAGAGCGTTCTGTGCGGGGTCTGAAGCGGAGGACCC
TTATTCACCGAAAGATCGCTTCGATCCTTGAGCAAGAGTGGCGAGACGAAGGAACAGTCCTGAACGAGCG
CAAAGCGCGATTGAAAGAGCGCAAGGCATCTTCGTCTGACCCTCTGTTTGAGACTGAGTCATGA

HomologuedndD
OrganismRoseobacter denitrificans OCh 114
GID1056
PID2056
Locus tagRD1_0800
Locations777108..779060
Length1953 bp
G+C%55
Link NCBI: gi:110677421  
SequenceATGATTTTACAGTCTCTTTGTCTCACTAATTTTGGTCTTTATGGCGGTGAACACCGCTTTGATCTTGCAC
CCGAGCCAGACGGGCAAAAACCTGTGGTTTTGGTTGTTGGCCATAATGGTGCCGGGAAGACAACGTTCCT
GGAATCTGTACGTTTGGCGCTCTACGGCAAACGCGCCCTCGGCGCGCGTGTTGGGCAGGCCGAGTATGAG
CGGCATCTCCTTAAACGGATCAACAACTTCGCCAAGGACCGCATCGCCTCTGTCGAACTGGCCTTCACGA
GCCAACACCTTGGTAACGAGGACCTCTACACCGTGCGTCGATCTTGGGCGGCCCGCGGTGCCAGCGTCAT
TGAAAGCCTTGAGTTTGAACGCAATGGCGCTCCGGTGGAGGATATCCCAAGCGAGGATTGGAACCACTAT
CTTGAAGACATCATTCCAGCTGGGGTGTCGCAGCTTTTCTTTTTCGATGGAGAGAAGATCCAAGATATTG
CTGACGATCAGGAAAGCACTGGGCTGACAGATGCAATCAAATCCTTGCTAGGAATCGATATTCTCGATCA
GCTTCGGGGCGATCTCGCCCTCTACAAATCACGCAGCATGGACCGGGATGGTGACACCGGCCTAGAAGGT
CTCCGGCGCGACCTAGAGGTCGCAAAGTCTGATCTGGTCTTGGCTGAAGAGGAGATTGGATCGCTATCAG
CAAAGCGCACCCAGCTTGCGCGCCGAAGCGAGGTTTCACAAAAAGTCTTTGAACAAGAGGGGGGCAGCAT
CGCGCTCAGCCGTGACACCCTGTCAGAGGAGCTAAAGCGGGTCGAAGCCGAACTGACCAAACAAACCAAC
GCGTTAAAGACGCGTGTAAACGGCGTCGCGCCATTTGCCCTGGCTCCAAATCTTCTTGAACGATTTTCAG
CAGACCTGGAGAAAGCGCGCGGACAGCAAAGCGCGACAGCAATCGAAGCCTTTGTCTCGAGTTTTCAGGC
GGCCGTAGGCAAAAGCGACGAGACCTGGACGAAGGCGCATTTTGCGCAGCTCAAAGACTTCGCCCGGAAC
CGCCAAAGCACCGGGCCCAGAATGGCTCTGAGCACGGAACCAGACTGGGTTTTGGCGAAACTTTCTCAGA
TTGCGGACGAACGGGTAAAGGTCGCCACATTGGCTGCGCAACTGGCCGAGCTGCAAAAGCAACGTACGAC
CTTGAAGGATCAGTTGAAGAACTTCCGCCCCGGTGCTGCCTCCGGTGCATTTGAGGAGTTGAAGAAAGCA
GAGTTCGAACTCGGCGCCATCGAAACTGAGCTTAATCGCAAGCAAGGTGAGGCGACACAGGCTCGTGCAC
TGATCGAACGCCTAGAGCGCGAGTTGCGCAAGTCCCAGGACGCCGTCTTCGCGCTTGCAAAGGCCGAAGA
GAAACGTGACCTGGCGACGCGAGCGCAGGCCGCGCTCAATGAGTATGAGGAGCGGATTGTTCAGCTGCGC
CTCGCCTCGCTTTCCAAGCATTTCATTGAGGCTTTCAGCGGTCTCGTCACGCGGAAGTCGCTGGTGCATG
ACGTGATCGTCGACCCCAACAGTTTTCAGCTTAAACTTATGGGCAGAGATGGCAGAGAGATTACCCCATC
CGAACTCTCCGCTGGCGAGCGGCAACTCTTTGCGATCTCAATGCTTTGGGCGCTCGGCCGAACAAGTGGG
CGCGAATTACCGATGATCATCGACACGCCGTTGTCGCGTTTGGACCGGAAACACCGGACAAACTTGATGG
CAAATTACGTACCGCGCAGCTCGGCGCAGGTCGTCATGCTGTGCACCGATACCGAGTTGACCCCGGATTT
GTCGAAAATCATCAAACCTTATGTGAGCCGACGTTTTGAGATTGGAACTGTGGGTGGTGGACAACGCACG
AAGATCACGGTGTTGAGTACCGAAGCGGAAGCACAGGTTCTGGAGACAACCGATGCACATTAA

HomologuedndE
OrganismRoseobacter denitrificans OCh 114
GID1072
PID2072
Locus tagRD1_0801
Locations779050..779424
Length375 bp
G+C%56
Link NCBI: gi:110677421  
SequenceATGCACATTAATAAGTTTCGGATCTCATCGACGGCGACCGGCCAGGTGCGGATCATTTCACAAAGATCTG
GGCTGACACCCAACCTCGTTTGCCGCATGGCCATGTTGTCATCCTTTGAAGCCGGGCCCATATCCGGCGC
CGCCGATGACGCTGGCGAGGGTCAAGAATTCAATGCCTATACGCTCTTTGGGGACTTCCAGCCTCTCTTC
ATCGACCTTCTGAAATATGTCGAGTTTGGAGCTGAGGAGATCGAAACCGACGACAGTGATTTGCTGGCGC
GCTTGCGATTGCACATTGATCGTGGTGTGCGGCAACTCTCGGTCCGGCTTAAATCCCCGGCGGATGCGGC
CGAACTGATCGCGGGGAGTGCGTGA