Summary Sequence Context  
1 homologue found:

HomologuedndA
OrganismRoseobacter denitrificans OCh 114
GID1007
PID2007
Locus tagRD1_0802
Locations779429..780592
Length1164 bp
G+C%55
Link NCBI: gi:110677421  
SequenceATGTCGGCACCGATTTACCTTGACCACAACGCTTCTACTCCGATTGATCCGGAAGTTTTGGAGACGGTCA
TACGTGTCAGTCGGGACGTATATGCGAACCCATCAAGTGTTGAGCATAGCCAAGGTTCAGGGGCTGCTCG
GGTTGTCGATACTGCGCGCGCGCAGATTGCGGGCCATCTCAATTGCAAGGAAACCGAGCTCGTCTTTACA
GCCGGGTCCACGGAAGCCAACAATCTTGCGATCCTTGGAGCGTTCCCTCGGCTCAAGGAGGCGGGGCGCA
CACATCTGATCACCAGCAAGATCGAGCACCCATCTGTTCTGGCCTGTTTCGACCATCTCGAATCCCAAGG
CGCACGGGTAACGCGATTGGGGGTAGATGAAGGTGGCCAGATTTCCCTCGATGAGCTGGCCCTGTCTTTG
ACGGATGAGACCGGATTCTTGTCCATCATGGCTGCCAACAATGAGACGGGCGTTTTGCAACCCATCTTGG
AAGCAGGCCAGCTTGCCGAAGAGGCTGGGGCGCTATTTCACACGGACTTCTCGCAAGCTTCGGCTTTTGT
GCCACTTGATCTCAAGAACGCGCCCATCCATCTGGCGAGTTTCTCTGGCCACAAGGCCTATGGCCCGAAA
GGGGTTGGGGCCCTTTACCGGTCGATCCGAAAACCGCGGGTCAACCTAGCCCCAGTGATGTTTGGTGGCG
GGCAGGAGAAGGGTTTGAGGGCAGGGACCCTGAACACGCCTGGCATTGCCGGCCTTGGACATGCATTTGA
GCTCATCTCAAAAAACATAGACCATGACCGGGATCGGATTGGGGCCCTGCGAGATCAGCTTGAAATCGAA
CTCAAAGAGACCTTAGCGGCGCAGGTCAATGGAAACACTGCAGCGAGGTTGCCAAACACGATGTCCCTCA
CGATCGACGGAGTTGTCCCACAAGCGCTGATGCAAAAGCTAAGAAACGACGTCTGCTTTTCTGCATCGAG
CGCCTGCGCCACAGAACATGTCGAAACCTCTCACGTTCTGCTCGCCATGTTCGGCGACACTCCAAGGGCG
CGAAATGCTTTCCGACTAGGTCTAGGCCGGCAAACCAGCAAAAAAGACATATCCAAAGTCATCAGACTCT
TTTTACAAGCCTCATCAGAACTCCTGCTTCTAAAAACAGCTTAG