Summary Sequence Context  
1 homologue found:

HomologuedndB
OrganismRoseobacter denitrificans OCh 114
GID1020
PID2020
Locus tagRD1_0798
Locations774545..775651
Length1107 bp
G+C%54
Link NCBI: gi:110677421  
SequenceATGAGCGGTAACTTCTATAATTTTGCAGCCATACGCGGCGTCCAGGCTGGAACCGAGTATTATGTGATCA
TGGTCCCTCTTAAGATGGTTCCAAAGATTTTCGAATTCGACAGTCAGGAATTGCCAGCAGACCTGCGCGC
TCAACGCGTATTGTCAAATGTCCGCGTTCCGCAAATCGCATCCTACCTCTCGGAAAACTTCGAAGAATAT
ACGCTCTCATCTCTCTGCGCATCTGTGGATGGTGATCTTGAGTTTTCCCCAGCCAGCGACGGTCTTCAGT
TCCGTAATGTAGGCGAGCTACGGCTTTCGATGACAGCCCGCATCATCCTAAACGACGGTCAGCATCGTCG
CGCCGCAATCGAAGAAGCCCTCAAGACGCGACCCAAGCTCGAAAACGAAACCATCTCGGTTGTGCTTTTC
CTCGATGAGGGGCTGGAGCGCTGCCAGCAAATGTTCGCAGACCTCAACAAGAATGCCGTACGCCCATCCG
GGTCGTTGAACGTCCTCTATGACCGCAGAAATCCTTTGGCACGTCTGAGCACGCGCGTGTTAGAGGACAT
TCCGTTTTTCCAAGAATTCACCGAGCTCGAAAAAACATCTCTTTCGAACCGGGCCAAAAACCTCTTTACC
TTGTCCAGCCTGAATCAAGCCAACAAGTGGCTCGCTGGGCAAGATGCGGATCGGTTCGGTGAAAACACTG
AAAGCACCGTGATCGCATATTGGCGTCAGGTTTCTGAGGTCATCCCAGACTGGCAGAAACTGATGCGTGG
CGCGACGACAGCAGGCGACCTGCGAAAAGAAACGGTTCATGCGCATGGCGTGATGCTGCAGGCTTTTGGA
GTCTTAGGGGCAAGACTGATTACAGCAAAGCCGGATGGATGGGCCGAAACCCTGGCTCCGCTCGCGGAGA
TCAATTGGAGCAAGCGCAATGCCCAGCTCTGGCGTCCTCGCGTCATGGGCGCGCGCGGAATGGATGGCAG
TGTGAAATCTGTACATCTGGCGGCCAACGTCCTAGTTGCGGCTGTAGGCTTGCCGCTCAATGAAAAAGAA
CAAGCGAATGAAGACGACTACCTGGCGTCATTGGCTGAGGAGAAAGTCGTCGCATGA