Summary Sequence Context  
1 homologue found:

HomologuedndC
OrganismRoseobacter denitrificans OCh 114
GID1038
PID2038
Locus tagRD1_0799
Locations775648..777111
Length1464 bp
G+C%56
Link NCBI: gi:110677421  
SequenceATGACATCAAAGAATGAAACCGACCAAACAAAGCGGGCAGGGCTCGATCTTGTCGCTCTGCAGGAAAATA
TCCGCGCGGTTTACGCGGCAGACGACCGGCCATGGGTGATCGGGTATAGCGGCGGAAAGGATTCAACCTG
TGCCTTGCAGCTAATCTGGAGTGCCATTCGTGCGCTTCCGGAAGACGCGAGACGCAAGCCAATCTTCGTC
CTCAGTTCCGACACGCTTGTCGAAACGCCCGTGATCGTAAACTACATCGACGATACCTTGGCAGCCATCA
ACGCGGCAGCGGCAGACCAGAACATGCCCATCACCGCACAAAAGGTGGTTCCGGAGATTTCAGATAGCTT
CTGGGTGAACCTGATTGGCCGCGGATATCCTGCACCGTCAAAGCGCTTTCGCTGGTGCACGGAGCGGCTG
AAGATCGATCCGGCCAATGCCTTCATCAAGAACCGCGTTGCCGAATATGGCGAGGTGGTCATGGTTCTGG
GCGTACGGTCCTCGGAAAGCGCGACACGCGCGCAGGTGATGTCGCTGCACAAGATCGATGGTACGGCTTT
GTCTCGCCATTCGACCTTACCCGGCGCTTTCGTCTTCACGCCGATCGAGACCTTCAGTGTGGATGATGTT
TGGGCTTTCTTGCTGCAAAATCAGTCACCTTGGGGATCGGACAACCGCGATTTGCTTGCGATGTATCGAA
ACGCGCAAGCTGGCGAGTGCCCACTTGTAGTCGATAAGCAAACTGAAAGCTGCGGGAATTCCCGCTTTGG
CTGCTGGGTGTGCACGGTTGTGACAAAGGACAAGGCCATGGAAGCGCTTGTTGAGAATGGCGAGGAATGG
CTTGAGCCTTTGCTTGATCTCCGTGACGAGCTGGCTGAAACACAAAACCCCGAGCGGAAACGAGAGTTTC
GAGATTTTCGCAGACGGGACGGCTCTGTGACCTTTGTGGGCGATGCAGAGACATCCATTCCGGGGCCCTA
TCTTTTCGAATACCGCAAAGAGCTCTTGAGAAAACTTCTGGAGGCGCAAGAGCGGGTAAATGCCAATGCG
CCACCCGGCGAGAAGACCGACCTTATTCAGGTCGAAGAACTCCGGGAAATCCGTCGGATCTGGCGGAGCG
AACAGGGTGACTGGGGCGACGCTGTTTCAGAGACCCTCAAAGCTGTGACGGGCAAGGAACTCCCAGCCGA
TGCGACCGACGGATTTGAATTCCAAGCCGATGACGCCAAGGTCTTGGCGGATGTCTGCGCCGCGCATGAC
TTGCCGTCACGTCTCTTGGCCCAGCTCCTGGAAGCAGAGCGTTCTGTGCGGGGTCTGAAGCGGAGGACCC
TTATTCACCGAAAGATCGCTTCGATCCTTGAGCAAGAGTGGCGAGACGAAGGAACAGTCCTGAACGAGCG
CAAAGCGCGATTGAAAGAGCGCAAGGCATCTTCGTCTGACCCTCTGTTTGAGACTGAGTCATGA