Summary Sequence Context  
1 homologue found:

HomologuedndD
OrganismRoseobacter denitrificans OCh 114
GID1056
PID2056
Locus tagRD1_0800
Locations777108..779060
Length1953 bp
G+C%55
Link NCBI: gi:110677421  
SequenceATGATTTTACAGTCTCTTTGTCTCACTAATTTTGGTCTTTATGGCGGTGAACACCGCTTTGATCTTGCAC
CCGAGCCAGACGGGCAAAAACCTGTGGTTTTGGTTGTTGGCCATAATGGTGCCGGGAAGACAACGTTCCT
GGAATCTGTACGTTTGGCGCTCTACGGCAAACGCGCCCTCGGCGCGCGTGTTGGGCAGGCCGAGTATGAG
CGGCATCTCCTTAAACGGATCAACAACTTCGCCAAGGACCGCATCGCCTCTGTCGAACTGGCCTTCACGA
GCCAACACCTTGGTAACGAGGACCTCTACACCGTGCGTCGATCTTGGGCGGCCCGCGGTGCCAGCGTCAT
TGAAAGCCTTGAGTTTGAACGCAATGGCGCTCCGGTGGAGGATATCCCAAGCGAGGATTGGAACCACTAT
CTTGAAGACATCATTCCAGCTGGGGTGTCGCAGCTTTTCTTTTTCGATGGAGAGAAGATCCAAGATATTG
CTGACGATCAGGAAAGCACTGGGCTGACAGATGCAATCAAATCCTTGCTAGGAATCGATATTCTCGATCA
GCTTCGGGGCGATCTCGCCCTCTACAAATCACGCAGCATGGACCGGGATGGTGACACCGGCCTAGAAGGT
CTCCGGCGCGACCTAGAGGTCGCAAAGTCTGATCTGGTCTTGGCTGAAGAGGAGATTGGATCGCTATCAG
CAAAGCGCACCCAGCTTGCGCGCCGAAGCGAGGTTTCACAAAAAGTCTTTGAACAAGAGGGGGGCAGCAT
CGCGCTCAGCCGTGACACCCTGTCAGAGGAGCTAAAGCGGGTCGAAGCCGAACTGACCAAACAAACCAAC
GCGTTAAAGACGCGTGTAAACGGCGTCGCGCCATTTGCCCTGGCTCCAAATCTTCTTGAACGATTTTCAG
CAGACCTGGAGAAAGCGCGCGGACAGCAAAGCGCGACAGCAATCGAAGCCTTTGTCTCGAGTTTTCAGGC
GGCCGTAGGCAAAAGCGACGAGACCTGGACGAAGGCGCATTTTGCGCAGCTCAAAGACTTCGCCCGGAAC
CGCCAAAGCACCGGGCCCAGAATGGCTCTGAGCACGGAACCAGACTGGGTTTTGGCGAAACTTTCTCAGA
TTGCGGACGAACGGGTAAAGGTCGCCACATTGGCTGCGCAACTGGCCGAGCTGCAAAAGCAACGTACGAC
CTTGAAGGATCAGTTGAAGAACTTCCGCCCCGGTGCTGCCTCCGGTGCATTTGAGGAGTTGAAGAAAGCA
GAGTTCGAACTCGGCGCCATCGAAACTGAGCTTAATCGCAAGCAAGGTGAGGCGACACAGGCTCGTGCAC
TGATCGAACGCCTAGAGCGCGAGTTGCGCAAGTCCCAGGACGCCGTCTTCGCGCTTGCAAAGGCCGAAGA
GAAACGTGACCTGGCGACGCGAGCGCAGGCCGCGCTCAATGAGTATGAGGAGCGGATTGTTCAGCTGCGC
CTCGCCTCGCTTTCCAAGCATTTCATTGAGGCTTTCAGCGGTCTCGTCACGCGGAAGTCGCTGGTGCATG
ACGTGATCGTCGACCCCAACAGTTTTCAGCTTAAACTTATGGGCAGAGATGGCAGAGAGATTACCCCATC
CGAACTCTCCGCTGGCGAGCGGCAACTCTTTGCGATCTCAATGCTTTGGGCGCTCGGCCGAACAAGTGGG
CGCGAATTACCGATGATCATCGACACGCCGTTGTCGCGTTTGGACCGGAAACACCGGACAAACTTGATGG
CAAATTACGTACCGCGCAGCTCGGCGCAGGTCGTCATGCTGTGCACCGATACCGAGTTGACCCCGGATTT
GTCGAAAATCATCAAACCTTATGTGAGCCGACGTTTTGAGATTGGAACTGTGGGTGGTGGACAACGCACG
AAGATCACGGTGTTGAGTACCGAAGCGGAAGCACAGGTTCTGGAGACAACCGATGCACATTAA