Summary Sequence Context  
1 homologue found:

HomologuedndE
OrganismRoseobacter denitrificans OCh 114
GID1072
PID2072
Locus tagRD1_0801
Locations779050..779424
Length375 bp
G+C%56
Link NCBI: gi:110677421  
SequenceATGCACATTAATAAGTTTCGGATCTCATCGACGGCGACCGGCCAGGTGCGGATCATTTCACAAAGATCTG
GGCTGACACCCAACCTCGTTTGCCGCATGGCCATGTTGTCATCCTTTGAAGCCGGGCCCATATCCGGCGC
CGCCGATGACGCTGGCGAGGGTCAAGAATTCAATGCCTATACGCTCTTTGGGGACTTCCAGCCTCTCTTC
ATCGACCTTCTGAAATATGTCGAGTTTGGAGCTGAGGAGATCGAAACCGACGACAGTGATTTGCTGGCGC
GCTTGCGATTGCACATTGATCGTGGTGTGCGGCAACTCTCGGTCCGGCTTAAATCCCCGGCGGATGCGGC
CGAACTGATCGCGGGGAGTGCGTGA