Summary Sequence Alignment 16S rRNA Context  
5 homologues found:

HomologuedndA
OrganismMesorhizobium sp. BNC1 plasmid3
GID1008
PID2008
Locus tagMeso_4569
Locations5861..7027
Length1167 bp
G+C%65
Link NCBI: gi:110347349  
SequenceGTGGCCAGTCCCCTCTATCTCGATCACAACGCTACGACGCCGATCGATCCAGCCGTTGTCGCCGCGATGG
AGCCCTTCCTGCGCGAGATATTCGGGAATCCGGCAAGCGTCGAACACGCGCATGGTCATGCGGCCGGGTT
GGCGGTGGACCGCGCGCGGGCGCAAGTGGCCGAAGCGCTGGGAGCGCAGCCTAAGGAGATCGTGTTCACC
GGCAGTTGCACCGAGGCAAACAACCTCGCGATCCTGGGCGTCGCACGGGCTCACCCTAACAAGAAGCATA
TCGTCACCACCGCAATCGAACACCCCGCGATCCTTGAGCCGGCCCGCGCGCTTGAGCGAGATGGCTGGCG
CGTCACGTACGCGCCGGTGGACGAGGCTGGTCGGGTGAGCGTCGATGCGATCGCGGATGCGATCACCGAC
GAAACGACCCTGGTCTCGGTAATGGCGGCAAACAACGAGGTCGGGACGCTTCAACCCATTCGGGCAATCG
GCGAACTCTGTGAAGCGCGCGGCGTGCTCTTCCACAGCGACCTGGCTCAGGTGGTCGCCTATGGCACGGT
GGACGTCGAGCGCGACCACATTCATTTGGCCAGCCTGTCAGCCCATAAGGCCTATGGGCCGAAGGGCATC
GGCGCGCTCTACATCCGCTCGCGCAAACCCAAGGCCCGCGTCGCCCCGATCTTCTTCGGCGGCGGTCAGG
AGCGCGGTCTGCGCCCGGGGACCTTGAACACCGCCGCTATAGTCGGGATGGGCGAAGCCTTGGCGATCGC
GCGGCGCTGCGCGCAGGCGGATGGCGTTCGTCTTCGTGCCATGTGCAACCTGTTTCGCGACAGGCTTCAA
ACAAGCCTGCCCGGCGTCAAGCTCAACGGGCACCCGGCGGAGCGGCTGGCCAACAACCTATCGTTCTCGA
TCGAAGGGGTCGAACCACTGGCCCTGATCCGCAACTTGCGAGCGGACCTGAGTTTCTCTGCCGCCAGCGC
CTGCGCAACGGACAAGATCGAGACTTCCCACGTCCTGAAGGCGATGTTCGGCGACACGGGGCGCGCGCGA
ACCGCGTTCCGGATCGCGCCAGGGCGTCACACCTCGCAAGCCGACATGGACTGCGCCCTTGACCTAATTC
TCGCCGAAGCGGGAATATTGAGCAGCTTCGCCCGGCCCGCGGCCTGA

HomologuedndB
OrganismMesorhizobium sp. BNC1 plasmid3
GID1021
PID2021
Locus tagMeso_4573
Locations10896..12008
Length1113 bp
G+C%61
Link NCBI: gi:110347349  
SequenceATGGACGGCAACAGCTTGGATTTTACGGCCATCCGCGGCGTGCAGGCTGGCAGCGCTTACTTTGTCATCA
TGGTCCCGCTGAAGGTCGTGCCACGGCTGTTCAAGTTCGACGACGAGGCTATGCCGGCTGAGTTGCGCGC
ACAACGGGTGTTGAACAGAGCGCGGGTCCCAGCGATCGCGGCCTACATCACCAACAACGCATCAGAATAT
ATTCTCTCGTCACTGTGCGCTTCGATCGACGGCGAGATCGAATTCGAACCGGCGGCGACGGAGGGTCCGT
TGCGAGCTGTCGGAAAGTTGCGCATCGCCATGGCCGCGACAATCCTCATCAATGACGGCCAGCACCGGCG
GGCGGCGATTGAAGAAGCGATCCGCGAACGACCGCTACTCGGCGATGAGACCATCTCAGTGGTGGTGTTC
GCCGATCGAGGTCTCAAGCGTTCGCAGCAGATGTTCGCGGACCTCAACATCCATGCGGTGCGGCCGACGA
AGTCGATCAAGCTGCTCTACAACCATCGCGACGCGTTGGCGGCCCTTTCTCGCGACGTCGTCGCTGCCGT
GCCGTTGTTTCGCGACTTCACTTGCTACGACAGCAGCAGCATTTCCAACCGGTCGATCAAGCTGTTCACG
CTTAGTAGCCTGCACCAGGCGACGGCCGAAGTGATCGGGAAAAGCGGCGCAGGCCAGGTGGAGCCTGACG
ACAAGGACAAGGCCATCGCCTTTTGGACGGCAGTTATTGCCAACATGCCGGATTGGCAGCGGGTGGGAAC
GCGTGACGTCGCCTCCTACGAGCTGCGGCGAGACTACATACACGCTCATGGCGTGGCGGTGCAGGCGATC
GCGACGGCAGGCGCGCAGTTGATGAAGAGCGTGCCAAAGGCTTGGCCAGCGCGTCTGGCCAAGCTGCGCA
CCATTGACTGGTCGCGGGCCAATCGTGCGCTTTGGGACAATCGCGCCTTGGTCGCCGGCAAGGTGAACAA
GTCGAAAAACAACGTAACCCTCGTGACCAATGTGGTTGTAACGGCTTTAGGCCTGCCGCTGTCCGCTGAA
GCCCAGCGGATCGAGGACCTCTACGCACCCTCAACCGAGGCGCGGCTGAAGGTCGCAAGCTGA

HomologuedndC
OrganismMesorhizobium sp. BNC1 plasmid3
GID1039
PID2039
Locus tagMeso_4572
Locations9409..10896
Length1488 bp
G+C%63
Link NCBI: gi:110347349  
SequenceATGGTGCGGCCCTCGCCTTTGGATGGTGCCATCGTCGAAAGCCGGCTCCGCGAGATACGGGAGGTATACC
TTTCCGACAATCGCCCATGGGTGATCGGCTATTCCGGCGGCAAAGACTCAACCTGCGCCCTACAGCTGGT
TTGGACAGCCCTGCTCGGCCTGCCCGCCGAACATCGGACGAAGCCGGTCTATGTGATCACCTCGGATACC
TTGGTCGAGACGCCAGTGATTGTCCGCTACATCGACGTGACGCTGGCCCGCATTGCGGCGGCCGCGGCCG
AACAGGGCCTACCTATTAAGACTGAGAAAGTGACGCCCAACGTTGACCGCAGCTTCTGGGTTAACCTGAT
CGGTCGGGGCTATCCCGCGCCATCTCGCCGGTTCCGCTGGTGCACCGAGCGCCTGAAAATCGAGCCGGCC
AACGACTTCATCAAGGCGCGCGTCGCCGAGTTCGGCGAGGTCGTTATGGTGTTGGGTGTTCGCTCGTCGG
AGAGCGCTACGCGGGCCCAGGTCATGTCGTTCCACCGCATCAAGGGCTCGGTGCTCTCCCGGCATTCCTC
GCTACAGAACGCCTTCGTCTATGGGCCCATCGAGGCCTTTTCGACGGACGATGTCTGGACCTACCTGCTG
CAAAGCCCGTCGCCTTGGGGGAACAACAACCGCGACCTCGTGGCGATGTATCGCAACGCCCAGGCGGGCG
AGTGTCCACTGGTGGTGGACACCACGACACCCAGCTGCGGCAATTCCCGGTTTGGGTGCTGGGTCTGCAC
CGTGGTCGAACGGGATCGCTCGATGGAGGCGATGATCGATTCCGGTGAGGATTGGCTTGAGCCACTTCTG
GAATTCCGAGATCTGCTGGCTGAGACTCAAACGCCCGAGAAGAAGCGGCTTTATCGGGAATTCCGTCGCC
GTAACGGCCACGTCTCCTTCATCCGGGGCACTGACACCCCCGTGCCCGGACCCTATACGCTGACCTACTG
CAAGACCCTCCTAGAGCGTCTGCTCGAAACGCAGGTGCGTGTACAGCGCGAGGCGCCGCCCGGCGACGAC
ACTCTGTTGATCCACGATGCGGAGCTGCATGAGATTCGCCGCATCTGGCGCGCTGAGCGGGGCGATTGGG
CCGACTCGGTTCCGACCATCGTGCGCGCGGCCATTGGCCGCGAGCTCGACTGGGTGATGGAAGACAGTGT
CAGGTTCACGGCTGAGGACGGCCGCCTGCTCGAGGAGGTTTGTAGCGAGCGTTCTGTGCCGACCGAGCTA
ATCATACGATTGCTCGACGTGGAACGCGCCGCCCATGGCCTGAAGCGCCGACACGCCATCCATACCCGGA
TCGAGGAGTTGTTTCGTCAGGAGTGGCGCGACCTCGAGACGGTGCTGCAGGAACGCCTGGGGAGCCGCTC
GGCGGACATTGTTGAGGTCGATGATCTCGAGGAGGCTGACGCGCTGGAGTTGCCATTAGGGGACGCGCAG
GCGGAGAGCGCGCCGTGA

HomologuedndD
OrganismMesorhizobium sp. BNC1 plasmid3
GID1057
PID2057
Locus tagMeso_4571
Locations7397..9412
Length2016 bp
G+C%65
Link NCBI: gi:110347349  
SequenceGTGATCCTGCGTAGCATCAGACTTGAAGACTTTGGCCTTTATGCGGGGGTGACCGATTTGGATCTCGTCC
CGCGACAGCGCTTGGGCGGTCCAACGCCGATCATTCTGATCGGTGGGAAGAACGGCGCTGGAAAGACGAC
GCTCCTGGAAGCGGTTCGCCTTGCGCTCTATGGTCGGCGAGCCCTTGGCGCTCGCGTCAGCCAAGCTGAC
TACGAGGCCTACCTGCGTCAACGTATCAATCGCGACGCGACAACTCCCGCGGCCGCCGTCGCCCTGGAGT
TCGACTACGCCGAGGCCGGGACGGTGCATCGCTACCGCGTCCGGCGGGAGTGGGCGGTGCGCGGCAAGAG
CCTTGTCGAGAGCTTGCTTCTCGACAAGGACGGAGCGGCAATCGCCTCGGTACCGCGCGAGGAATGGCAC
CACTTCCTTCAGGAGCTGATCCCCCCTGGAGTTTCGCAACTGTTCTTTTTCGATGGCGAGAAGATCGGCG
AGATCGCCGATGCCGAGGAAGACAACGAGCAGTTGGCCGAAGCCGTTCGGGGCCTGCTCGGGATCGAGCT
GGTCGGCCGCCTGCGCACTGACTTGGGGCTCTATCTCGCCCGGCATCAGCGGGACGATGATGGGGAACTC
GTCACTCGTCTTGAAAACCTGCTCCGCGACATCAGCGTCGCCGAGCGCCAAGCCACGGTGCTGGGCGACG
AGGTTGCCGAGTTCACGTCGGCGCGAGACTCCCAGGCGCGCGCGGCGGAGCAGGTGAGGCGCCGATTTGT
CGCCGAAGGCGGTGACGCGGCGGTTCATCGGGTCCGGATCGAGGCCGAACGTGAGGAAGTCCGGCGCGCC
ATGCACCGCAGCGAGCATGAACTTCGGGATCTCGCCAACAAGCTACTGCCGTTCTCTATGGCGCCGAAGC
TGATTGGCGCGTTCCGCAAAGCGCTGTCCCGCGTGAGCGGTGGCGACGCTACGGCGATGTCCACCGAAGC
GCTAGAGAAAGCGCTGGTAGCTTGGCGCACCGGCGACGGGCCTAAGCGTAACGCTGCCTGGAGCGAAAAG
CACTGGACCGACCTTCGACGTTTCATGGAAGCCCATAGCGGCAGGGCGGCACTGGCTGTGACGTCGCCGG
CGTTCCGCGAAGTGGGTGACGGCACCGCAGCCTTGACCCGGCTGGCGGAGGTCGAAACCGTGGTGCGGCC
GCGGGCGCTCGCCCTGCTGGACGAATTTGACGCGCTCGCTCGGCGCAGTCGCGAGTTGGAGGTCATGCTC
GCTCGGGCCGATAACGCCGCCTCGGGGATCATGCTCGACGAGCTGCGCTTAGCCGATCAAAGGGTCGGAT
CGACGGAATCGCTCCTCAAGGGTAAGCAAGAGGAGCTCAAGCTGCTCCGGGGCCAGTTGGTCACGATGGA
GCGTGAGCGCCGACGTCTTCTTGAGGAGCAGGCCGGTTCGGACGCCGCGACGCACCGGGCGGAACTCGCC
TCCCGGACTGCACAGGCCCTCGCGGACTACGAGCATCGCCTTTTGGACCACAAGCTTACGCAGCTGCGCG
CCGAATTCGTGCGCTGCTTCAATCACCTCGTGCGAAAGGTCGATCTAATCGCCGACGTGCGCATCGACTC
GGCGTCCTTCGCGGCCACCCTGATAGACGCTGCCGGCCGCGAAGTGCCGAAGGCGGCACTCTCGGCGGGA
GAAAAGCAGGTCTACGCCATAGCCATGCTATGGGCTTTGGCGCGGACCAGCGGCCGGCCGCTGCCGATGA
TTATCGACACCCCGCTGGCGCGGCTTGATTCCGAGCACCGAGCCAATCTCGTCGGACGTTATTTTCCTGC
CGCGTCACATCAGGTGATCTTGCTATCGACCGACACCGAAATCGACGATCACCTCGTCGGGGACCTGCAG
GCCAGCGTCTCGCACGCCTATCGCCTGGACTATGACCCGGCCAGCGGCCGAACGGTGGCCTCGCATGGCT
ACTTCGCTGATACCCAAACCAAGCGGGAGGGCCGTCGTGCACTACAGCAAGCTTAG

HomologuedndE
OrganismMesorhizobium sp. BNC1 plasmid3
GID1073
PID2073
Locus tagMeso_4570
Locations7039..7416
Length378 bp
G+C%65
Link NCBI: gi:110347349  
SequenceGTGCACTACAGCAAGCTTAGGATTTCCGCTGACGCCACCAGCAAGCTGCGGTCGCTGCGCCAGCGCACAG
GCGTCACACCCAACCTGCTTTGCCGGATGGCCATCATGACCTCGCTCGAGGAAGGCCCGCTTGGCGGCGC
CGCCATACCAGACGAGGACGGCTCGGAGTTCAACGCCTACACGCTAACTGGCGAGTATGGGGCATTGATA
GCCGCCTTTCTGCGCTTCGTCGAAGAGGGCCAGGAACCCGACCCGCCGCTCGAGGACGAGATTTTGCTGG
ACCGGTTGCGGGGCCACATTCATCGGGGCGTCGGGACTTTGTCGGTGCGGGCAAAGTCGCCGGCCGACAT
CCTGCGCCTCGTGCCGACTTCCGCCTGA