Summary Sequence Context  
1 homologue found:

HomologuedndA
OrganismMesorhizobium sp. BNC1 plasmid3
GID1008
PID2008
Locus tagMeso_4569
Locations5861..7027
Length1167 bp
G+C%65
Link NCBI: gi:110347349  
SequenceGTGGCCAGTCCCCTCTATCTCGATCACAACGCTACGACGCCGATCGATCCAGCCGTTGTCGCCGCGATGG
AGCCCTTCCTGCGCGAGATATTCGGGAATCCGGCAAGCGTCGAACACGCGCATGGTCATGCGGCCGGGTT
GGCGGTGGACCGCGCGCGGGCGCAAGTGGCCGAAGCGCTGGGAGCGCAGCCTAAGGAGATCGTGTTCACC
GGCAGTTGCACCGAGGCAAACAACCTCGCGATCCTGGGCGTCGCACGGGCTCACCCTAACAAGAAGCATA
TCGTCACCACCGCAATCGAACACCCCGCGATCCTTGAGCCGGCCCGCGCGCTTGAGCGAGATGGCTGGCG
CGTCACGTACGCGCCGGTGGACGAGGCTGGTCGGGTGAGCGTCGATGCGATCGCGGATGCGATCACCGAC
GAAACGACCCTGGTCTCGGTAATGGCGGCAAACAACGAGGTCGGGACGCTTCAACCCATTCGGGCAATCG
GCGAACTCTGTGAAGCGCGCGGCGTGCTCTTCCACAGCGACCTGGCTCAGGTGGTCGCCTATGGCACGGT
GGACGTCGAGCGCGACCACATTCATTTGGCCAGCCTGTCAGCCCATAAGGCCTATGGGCCGAAGGGCATC
GGCGCGCTCTACATCCGCTCGCGCAAACCCAAGGCCCGCGTCGCCCCGATCTTCTTCGGCGGCGGTCAGG
AGCGCGGTCTGCGCCCGGGGACCTTGAACACCGCCGCTATAGTCGGGATGGGCGAAGCCTTGGCGATCGC
GCGGCGCTGCGCGCAGGCGGATGGCGTTCGTCTTCGTGCCATGTGCAACCTGTTTCGCGACAGGCTTCAA
ACAAGCCTGCCCGGCGTCAAGCTCAACGGGCACCCGGCGGAGCGGCTGGCCAACAACCTATCGTTCTCGA
TCGAAGGGGTCGAACCACTGGCCCTGATCCGCAACTTGCGAGCGGACCTGAGTTTCTCTGCCGCCAGCGC
CTGCGCAACGGACAAGATCGAGACTTCCCACGTCCTGAAGGCGATGTTCGGCGACACGGGGCGCGCGCGA
ACCGCGTTCCGGATCGCGCCAGGGCGTCACACCTCGCAAGCCGACATGGACTGCGCCCTTGACCTAATTC
TCGCCGAAGCGGGAATATTGAGCAGCTTCGCCCGGCCCGCGGCCTGA