Summary Sequence Context  
1 homologue found:

HomologuedndB
OrganismMesorhizobium sp. BNC1 plasmid3
GID1021
PID2021
Locus tagMeso_4573
Locations10896..12008
Length1113 bp
G+C%61
Link NCBI: gi:110347349  
SequenceATGGACGGCAACAGCTTGGATTTTACGGCCATCCGCGGCGTGCAGGCTGGCAGCGCTTACTTTGTCATCA
TGGTCCCGCTGAAGGTCGTGCCACGGCTGTTCAAGTTCGACGACGAGGCTATGCCGGCTGAGTTGCGCGC
ACAACGGGTGTTGAACAGAGCGCGGGTCCCAGCGATCGCGGCCTACATCACCAACAACGCATCAGAATAT
ATTCTCTCGTCACTGTGCGCTTCGATCGACGGCGAGATCGAATTCGAACCGGCGGCGACGGAGGGTCCGT
TGCGAGCTGTCGGAAAGTTGCGCATCGCCATGGCCGCGACAATCCTCATCAATGACGGCCAGCACCGGCG
GGCGGCGATTGAAGAAGCGATCCGCGAACGACCGCTACTCGGCGATGAGACCATCTCAGTGGTGGTGTTC
GCCGATCGAGGTCTCAAGCGTTCGCAGCAGATGTTCGCGGACCTCAACATCCATGCGGTGCGGCCGACGA
AGTCGATCAAGCTGCTCTACAACCATCGCGACGCGTTGGCGGCCCTTTCTCGCGACGTCGTCGCTGCCGT
GCCGTTGTTTCGCGACTTCACTTGCTACGACAGCAGCAGCATTTCCAACCGGTCGATCAAGCTGTTCACG
CTTAGTAGCCTGCACCAGGCGACGGCCGAAGTGATCGGGAAAAGCGGCGCAGGCCAGGTGGAGCCTGACG
ACAAGGACAAGGCCATCGCCTTTTGGACGGCAGTTATTGCCAACATGCCGGATTGGCAGCGGGTGGGAAC
GCGTGACGTCGCCTCCTACGAGCTGCGGCGAGACTACATACACGCTCATGGCGTGGCGGTGCAGGCGATC
GCGACGGCAGGCGCGCAGTTGATGAAGAGCGTGCCAAAGGCTTGGCCAGCGCGTCTGGCCAAGCTGCGCA
CCATTGACTGGTCGCGGGCCAATCGTGCGCTTTGGGACAATCGCGCCTTGGTCGCCGGCAAGGTGAACAA
GTCGAAAAACAACGTAACCCTCGTGACCAATGTGGTTGTAACGGCTTTAGGCCTGCCGCTGTCCGCTGAA
GCCCAGCGGATCGAGGACCTCTACGCACCCTCAACCGAGGCGCGGCTGAAGGTCGCAAGCTGA