Summary Sequence Context  
1 homologue found:

HomologuedndC
OrganismMesorhizobium sp. BNC1 plasmid3
GID1039
PID2039
Locus tagMeso_4572
Locations9409..10896
Length1488 bp
G+C%63
Link NCBI: gi:110347349  
SequenceATGGTGCGGCCCTCGCCTTTGGATGGTGCCATCGTCGAAAGCCGGCTCCGCGAGATACGGGAGGTATACC
TTTCCGACAATCGCCCATGGGTGATCGGCTATTCCGGCGGCAAAGACTCAACCTGCGCCCTACAGCTGGT
TTGGACAGCCCTGCTCGGCCTGCCCGCCGAACATCGGACGAAGCCGGTCTATGTGATCACCTCGGATACC
TTGGTCGAGACGCCAGTGATTGTCCGCTACATCGACGTGACGCTGGCCCGCATTGCGGCGGCCGCGGCCG
AACAGGGCCTACCTATTAAGACTGAGAAAGTGACGCCCAACGTTGACCGCAGCTTCTGGGTTAACCTGAT
CGGTCGGGGCTATCCCGCGCCATCTCGCCGGTTCCGCTGGTGCACCGAGCGCCTGAAAATCGAGCCGGCC
AACGACTTCATCAAGGCGCGCGTCGCCGAGTTCGGCGAGGTCGTTATGGTGTTGGGTGTTCGCTCGTCGG
AGAGCGCTACGCGGGCCCAGGTCATGTCGTTCCACCGCATCAAGGGCTCGGTGCTCTCCCGGCATTCCTC
GCTACAGAACGCCTTCGTCTATGGGCCCATCGAGGCCTTTTCGACGGACGATGTCTGGACCTACCTGCTG
CAAAGCCCGTCGCCTTGGGGGAACAACAACCGCGACCTCGTGGCGATGTATCGCAACGCCCAGGCGGGCG
AGTGTCCACTGGTGGTGGACACCACGACACCCAGCTGCGGCAATTCCCGGTTTGGGTGCTGGGTCTGCAC
CGTGGTCGAACGGGATCGCTCGATGGAGGCGATGATCGATTCCGGTGAGGATTGGCTTGAGCCACTTCTG
GAATTCCGAGATCTGCTGGCTGAGACTCAAACGCCCGAGAAGAAGCGGCTTTATCGGGAATTCCGTCGCC
GTAACGGCCACGTCTCCTTCATCCGGGGCACTGACACCCCCGTGCCCGGACCCTATACGCTGACCTACTG
CAAGACCCTCCTAGAGCGTCTGCTCGAAACGCAGGTGCGTGTACAGCGCGAGGCGCCGCCCGGCGACGAC
ACTCTGTTGATCCACGATGCGGAGCTGCATGAGATTCGCCGCATCTGGCGCGCTGAGCGGGGCGATTGGG
CCGACTCGGTTCCGACCATCGTGCGCGCGGCCATTGGCCGCGAGCTCGACTGGGTGATGGAAGACAGTGT
CAGGTTCACGGCTGAGGACGGCCGCCTGCTCGAGGAGGTTTGTAGCGAGCGTTCTGTGCCGACCGAGCTA
ATCATACGATTGCTCGACGTGGAACGCGCCGCCCATGGCCTGAAGCGCCGACACGCCATCCATACCCGGA
TCGAGGAGTTGTTTCGTCAGGAGTGGCGCGACCTCGAGACGGTGCTGCAGGAACGCCTGGGGAGCCGCTC
GGCGGACATTGTTGAGGTCGATGATCTCGAGGAGGCTGACGCGCTGGAGTTGCCATTAGGGGACGCGCAG
GCGGAGAGCGCGCCGTGA