Summary Sequence Context  
1 homologue found:

HomologuedndD
OrganismMesorhizobium sp. BNC1 plasmid3
GID1057
PID2057
Locus tagMeso_4571
Locations7397..9412
Length2016 bp
G+C%65
Link NCBI: gi:110347349  
SequenceGTGATCCTGCGTAGCATCAGACTTGAAGACTTTGGCCTTTATGCGGGGGTGACCGATTTGGATCTCGTCC
CGCGACAGCGCTTGGGCGGTCCAACGCCGATCATTCTGATCGGTGGGAAGAACGGCGCTGGAAAGACGAC
GCTCCTGGAAGCGGTTCGCCTTGCGCTCTATGGTCGGCGAGCCCTTGGCGCTCGCGTCAGCCAAGCTGAC
TACGAGGCCTACCTGCGTCAACGTATCAATCGCGACGCGACAACTCCCGCGGCCGCCGTCGCCCTGGAGT
TCGACTACGCCGAGGCCGGGACGGTGCATCGCTACCGCGTCCGGCGGGAGTGGGCGGTGCGCGGCAAGAG
CCTTGTCGAGAGCTTGCTTCTCGACAAGGACGGAGCGGCAATCGCCTCGGTACCGCGCGAGGAATGGCAC
CACTTCCTTCAGGAGCTGATCCCCCCTGGAGTTTCGCAACTGTTCTTTTTCGATGGCGAGAAGATCGGCG
AGATCGCCGATGCCGAGGAAGACAACGAGCAGTTGGCCGAAGCCGTTCGGGGCCTGCTCGGGATCGAGCT
GGTCGGCCGCCTGCGCACTGACTTGGGGCTCTATCTCGCCCGGCATCAGCGGGACGATGATGGGGAACTC
GTCACTCGTCTTGAAAACCTGCTCCGCGACATCAGCGTCGCCGAGCGCCAAGCCACGGTGCTGGGCGACG
AGGTTGCCGAGTTCACGTCGGCGCGAGACTCCCAGGCGCGCGCGGCGGAGCAGGTGAGGCGCCGATTTGT
CGCCGAAGGCGGTGACGCGGCGGTTCATCGGGTCCGGATCGAGGCCGAACGTGAGGAAGTCCGGCGCGCC
ATGCACCGCAGCGAGCATGAACTTCGGGATCTCGCCAACAAGCTACTGCCGTTCTCTATGGCGCCGAAGC
TGATTGGCGCGTTCCGCAAAGCGCTGTCCCGCGTGAGCGGTGGCGACGCTACGGCGATGTCCACCGAAGC
GCTAGAGAAAGCGCTGGTAGCTTGGCGCACCGGCGACGGGCCTAAGCGTAACGCTGCCTGGAGCGAAAAG
CACTGGACCGACCTTCGACGTTTCATGGAAGCCCATAGCGGCAGGGCGGCACTGGCTGTGACGTCGCCGG
CGTTCCGCGAAGTGGGTGACGGCACCGCAGCCTTGACCCGGCTGGCGGAGGTCGAAACCGTGGTGCGGCC
GCGGGCGCTCGCCCTGCTGGACGAATTTGACGCGCTCGCTCGGCGCAGTCGCGAGTTGGAGGTCATGCTC
GCTCGGGCCGATAACGCCGCCTCGGGGATCATGCTCGACGAGCTGCGCTTAGCCGATCAAAGGGTCGGAT
CGACGGAATCGCTCCTCAAGGGTAAGCAAGAGGAGCTCAAGCTGCTCCGGGGCCAGTTGGTCACGATGGA
GCGTGAGCGCCGACGTCTTCTTGAGGAGCAGGCCGGTTCGGACGCCGCGACGCACCGGGCGGAACTCGCC
TCCCGGACTGCACAGGCCCTCGCGGACTACGAGCATCGCCTTTTGGACCACAAGCTTACGCAGCTGCGCG
CCGAATTCGTGCGCTGCTTCAATCACCTCGTGCGAAAGGTCGATCTAATCGCCGACGTGCGCATCGACTC
GGCGTCCTTCGCGGCCACCCTGATAGACGCTGCCGGCCGCGAAGTGCCGAAGGCGGCACTCTCGGCGGGA
GAAAAGCAGGTCTACGCCATAGCCATGCTATGGGCTTTGGCGCGGACCAGCGGCCGGCCGCTGCCGATGA
TTATCGACACCCCGCTGGCGCGGCTTGATTCCGAGCACCGAGCCAATCTCGTCGGACGTTATTTTCCTGC
CGCGTCACATCAGGTGATCTTGCTATCGACCGACACCGAAATCGACGATCACCTCGTCGGGGACCTGCAG
GCCAGCGTCTCGCACGCCTATCGCCTGGACTATGACCCGGCCAGCGGCCGAACGGTGGCCTCGCATGGCT
ACTTCGCTGATACCCAAACCAAGCGGGAGGGCCGTCGTGCACTACAGCAAGCTTAG