Summary Sequence Context  
1 homologue found:

HomologuedndE
OrganismMesorhizobium sp. BNC1 plasmid3
GID1073
PID2073
Locus tagMeso_4570
Locations7039..7416
Length378 bp
G+C%65
Link NCBI: gi:110347349  
SequenceGTGCACTACAGCAAGCTTAGGATTTCCGCTGACGCCACCAGCAAGCTGCGGTCGCTGCGCCAGCGCACAG
GCGTCACACCCAACCTGCTTTGCCGGATGGCCATCATGACCTCGCTCGAGGAAGGCCCGCTTGGCGGCGC
CGCCATACCAGACGAGGACGGCTCGGAGTTCAACGCCTACACGCTAACTGGCGAGTATGGGGCATTGATA
GCCGCCTTTCTGCGCTTCGTCGAAGAGGGCCAGGAACCCGACCCGCCGCTCGAGGACGAGATTTTGCTGG
ACCGGTTGCGGGGCCACATTCATCGGGGCGTCGGGACTTTGTCGGTGCGGGCAAAGTCGCCGGCCGACAT
CCTGCGCCTCGTGCCGACTTCCGCCTGA