Summary Sequence Alignment 16S rRNA Context  
4 homologues found:

HomologuedndB
OrganismVibrio cholerae MZO-2
GID1022
PID2022
Locus tagA5A_0794
Locations62385..63464
Length1080 bp
G+C%41
Link NCBI: gi:120616157  
SequenceATGCACAATCAAGATTCCGGCTATTGCTACTCATTCCCTGCGGTTAGAGGTATTCAAGCCGGGCGACCAT
TTTACATCGCGACTTGTCCTCTACGGATTATCCCCAAAATTTTTAGTTACAACGAAGATGATGTTCCACC
CGAATTACGAGCACAAAGAACATTAAATAAGACCCGTATTCCAGAAATGGTGAGGTACTTACTTGATAAT
CCAAAGGATTATGTCTTTTCAGCGTTAACCGCATCAGTAGGAATTGATATCTGTTTCGAAGACCACGATG
GAGCTCCAAATCTAGGAATCCTAAAAATTCCCATGGACGCTCAAATATTGATCAACGATGGTCAACATAG
ACGTAAAGCTATCGAAGAAGCGCTACGAGAAAATCCAGACTTAGGGCAAGACAACATTCCAGTGCTATTT
TTTGTCGATGAAGGCTTAAAACGTAGCCAGCAAATGTTTGCGGATCTCAATAAATACGCAGTAAAACCTA
GCCCTTCTTTAGGGGTTTTATACGACCTTAGAGATGAAAGCTCGGAGCTCGCGAGAAGATTGGCTACTCA
CTGTATGCCTTTTATCGGCTTAACTGAGATGGAAAAATCGAATATCAGCCCTAAATCGAACAAACTTTTT
ACTTTGAGTAGTATCAAACAAGCCACAAGAGCTCTTCTTGGAAAAGGGGCAAAAGATGGTTTTACAAAAG
AAGAAAAAGCATTAGCTGAATCATTTTGGAAAATCGTCGCAGAAAACATGCCTGACTGGCAAATGGTTAT
ATCTAAACAAGTTTCTCCTGCGCAACTTAGACAAGAATATATTCACGCGCACGGGGTCGGCTTGCACGCT
ATTGGGGTCATGGGGAACTCTTTACTCTGTGAAGAGCCTGAAAAATGGGCTGAAAAACTCAAAAAGCTGA
GAAACATAAATTGGCTAAAAACCAACCCTGAATGGATAAAGCGTAGTATGAATCTAGGGAAAGTCAGTAA
ATCTACCCTCAACATTCAACTCACAGCAAACTACTTGAAAATAAGTCTTGCGTTACCGTTAACCCCCGAA
GAAAAAGCTCTAGAGAAGCAGTTATCATGA

HomologuedndC
OrganismVibrio cholerae MZO-2
GID1040
PID2040
Locus tagA5A_0793
Locations63461..65092
Length1632 bp
G+C%43
Link NCBI: gi:120616157  
SequenceATGATACACGAGCTAAAATTGGCGGAAGATCTTGCCGAATACGAAGATTTCATTAATCACGAAGACTTCG
CAAATAACAAACTGAGTCACTACATCGCTGATGTTCAACGGGTTTACTGCGCAGATAAACGCCCATGGGT
CATTGGATACAGTGGTGGTAAAGACTCGTCTGCCGTAATGTCATTGGTTTACATGGCATTACTCGGATTA
GAGCCAAAAGATCGAAGCAAACCTGTTTTTGTTGTCTCCTCGGATACTCTGGTAGAAACCCCTGTAGTGG
TAAACCATATCAAAGACTCATTAAATGCCATTGAAAAAGGTGCCAAACGCGATCTACTACCCATTACCTG
CCACAAAGTGGTACCCGAAAACAACCAAACTTTTTGGGCAAACTTACTAGGTAAGGGCTATCCAGCACCA
ACAAGGTCTTTCCGTTGGTGCACTGAGCGTATGAAAATTGATCCGGTCAGCGACTTTATTAAATCCAAAG
TATCCCAATACGATGAAGTGATCGTTGTATTAGGCTCTCGCAGTCAAGAAAGTGCATCACGTGCACAGGT
CATTGCAAAACATAAGATTGACGGCTCACGTCTCGCGCGCCACACAACATTATCAAATGCTTTTATCTAT
ACGCCGATTGACACATGGGGAGTTGATGATGTTTGGAAAATACTACGCCTTTGCCACCTAGAAACGAAAG
AAACCCCTTACGGTACTAAAAATATCTGGATCGATAAGTATGACCTAGAGTGGGAAAATCCATGGGGAGG
AAAAAACCTAGTCCTCTGGAATTTATATAAAGACTCTTCTGGTCAGGGCGAATGTCCTATGGTCATTGAT
GAGACAACTCCATCTTGCGGTAACTCTCGCTTTGGTTGCTGGACTTGTACCGTCGTAACCAAAGATCGTG
CTATGGAAAGCCTTATCCAAAATGGCGAAGAGTGGATGTCACCACTACTTGAATTTCGCAACAAGTTGTC
CATGACAACAGAACCGGCAAACAAAGAAGAATTTAGAAACTACAAGCGCCGCACTGGAAAAGTGAGCTAT
CAATACGCCAAAGAGGGAGAAGATATTGCTTCTGAGCGCAAGCATGTCCCCGGCCCCTATTGGATGAAAT
ACCGGCAACAATGGCTGAAAGAGCTACTTGAATTAGACAAAAAATTCAAAAGTGAAGGCCGAGAAATTGA
GTTAATTACCGCCCCTGAATTGCATGCAATTCGTCAAGAGTGGATTCACGATCCAAATGAACCAGATTGG
GATGATTCTCTCCCCATGATATTTAGAGAAGTCTACGGTTACGATCTGGATTGGGTTTATGACGATAACG
CGAGCTTCGGAAAAGGTGACGCCCAACTGATCAGTGAGCTATGTCAGGATTTCGATGTCGAACCAGAAAT
GATCATGAAACTTATTGAGCTTGAAGTTTCTACTGAAGGTTTGAGTAGACGGAATGGCATCTCCAATAAA
ATCGCCTCATTACTAAAACAAGATTGGGGAAGTTTAGAAGAGATCAAACAAAAGCATGCATCGCTACAAA
GCAAAGCTGAATTTGATGTTCATCAGCAAGAGATTGAGCGTTACAACCAGCAGCTTGCCGATCTCGATAA
ACAGCTTCAAAAAGAGTTTTAA

HomologuedndD
OrganismVibrio cholerae MZO-2
GID1058
PID2058
Locus tagA5A_0792
Locations65101..67110
Length2010 bp
G+C%43
Link NCBI: gi:120616157  
SequenceATGATACACGAGCTAAAATTGGCGGAAGATCTTGCCGAATACGAAGATTTCATTAATCACGAAGACTTCG
CAAATAACAAACTGAGTCACTACATCGCTGATGTTCAACGGGTTTACTGCGCAGATAAACGCCCATGGGT
CATTGGATACAGTGGTGGTAAAGACTCGTCTGCCGTAATGTCATTGGTTTACATGGCATTACTCGGATTA
GAGCCAAAAGATCGAAGCAAACCTGTTTTTGTTGTCTCCTCGGATACTCTGGTAGAAACCCCTGTAGTGG
TAAACCATATCAAAGACTCATTAAATGCCATTGAAAAAGGTGCCAAACGCGATCTACTACCCATTACCTG
CCACAAAGTGGTACCCGAAAACAACCAAACTTTTTGGGCAAACTTACTAGGTAAGGGCTATCCAGCACCA
ACAAGGTCTTTCCGTTGGTGCACTGAGCGTATGAAAATTGATCCGGTCAGCGACTTTATTAAATCCAAAG
TATCCCAATACGATGAAGTGATCGTTGTATTAGGCTCTCGCAGTCAAGAAAGTGCATCACGTGCACAGGT
CATTGCAAAACATAAGATTGACGGCTCACGTCTCGCGCGCCACACAACATTATCAAATGCTTTTATCTAT
ACGCCGATTGACACATGGGGAGTTGATGATGTTTGGAAAATACTACGCCTTTGCCACCTAGAAACGAAAG
AAACCCCTTACGGTACTAAAAATATCTGGATCGATAAGTATGACCTAGAGTGGGAAAATCCATGGGGAGG
AAAAAACCTAGTCCTCTGGAATTTATATAAAGACTCTTCTGGTCAGGGCGAATGTCCTATGGTCATTGAT
GAGACAACTCCATCTTGCGGTAACTCTCGCTTTGGTTGCTGGACTTGTACCGTCGTAACCAAAGATCGTG
CTATGGAAAGCCTTATCCAAAATGGCGAAGAGTGGATGTCACCACTACTTGAATTTCGCAACAAGTTGTC
CATGACAACAGAACCGGCAAACAAAGAAGAATTTAGAAACTACAAGCGCCGCACTGGAAAAGTGAGCTAT
CAATACGCCAAAGAGGGAGAAGATATTGCTTCTGAGCGCAAGCATGTCCCCGGCCCCTATTGGATGAAAT
ACCGGCAACAATGGCTGAAAGAGCTACTTGAATTAGACAAAAAATTCAAAAGTGAAGGCCGAGAAATTGA
GTTAATTACCGCCCCTGAATTGCATGCAATTCGTCAAGAGTGGATTCACGATCCAAATGAACCAGATTGG
GATGATTCTCTCCCCATGATATTTAGAGAAGTCTACGGTTACGATCTGGATTGGGTTTATGACGATAACG
CGAGCTTCGGAAAAGGTGACGCCCAACTGATCAGTGAGCTATGTCAGGATTTCGATGTCGAACCAGAAAT
GATCATGAAACTTATTGAGCTTGAAGTTTCTACTGAAGGTTTGAGTAGACGGAATGGCATCTCCAATAAA
ATCGCCTCATTACTAAAACAAGATTGGGGAAGTTTAGAAGAGATCAAACAAAAGCATGCATCGCTACAAA
GCAAAGCTGAATTTGATGTTCATCAGCAAGAGATTGAGCGTTACAACCAGCAGCTTGCCGATCTCGATAA
ACAGCTTCAAAAAGAGTTTTAA

HomologuedndE
OrganismVibrio cholerae MZO-2
GID1074
PID2074
Locus tagA5A_0791
Locations67110..67457
Length348 bp
G+C%41
Link NCBI: gi:120616157  
SequenceATGCACAATCAAGATTCCGGCTATTGCTACTCATTCCCTGCGGTTAGAGGTATTCAAGCCGGGCGACCAT
TTTACATCGCGACTTGTCCTCTACGGATTATCCCCAAAATTTTTAGTTACAACGAAGATGATGTTCCACC
CGAATTACGAGCACAAAGAACATTAAATAAGACCCGTATTCCAGAAATGGTGAGGTACTTACTTGATAAT
CCAAAGGATTATGTCTTTTCAGCGTTAACCGCATCAGTAGGAATTGATATCTGTTTCGAAGACCACGATG
GAGCTCCAAATCTAGGAATCCTAAAAATTCCCATGGACGCTCAAATATTGATCAACGATGGTCAACATAG
ACGTAAAGCTATCGAAGAAGCGCTACGAGAAAATCCAGACTTAGGGCAAGACAACATTCCAGTGCTATTT
TTTGTCGATGAAGGCTTAAAACGTAGCCAGCAAATGTTTGCGGATCTCAATAAATACGCAGTAAAACCTA
GCCCTTCTTTAGGGGTTTTATACGACCTTAGAGATGAAAGCTCGGAGCTCGCGAGAAGATTGGCTACTCA
CTGTATGCCTTTTATCGGCTTAACTGAGATGGAAAAATCGAATATCAGCCCTAAATCGAACAAACTTTTT
ACTTTGAGTAGTATCAAACAAGCCACAAGAGCTCTTCTTGGAAAAGGGGCAAAAGATGGTTTTACAAAAG
AAGAAAAAGCATTAGCTGAATCATTTTGGAAAATCGTCGCAGAAAACATGCCTGACTGGCAAATGGTTAT
ATCTAAACAAGTTTCTCCTGCGCAACTTAGACAAGAATATATTCACGCGCACGGGGTCGGCTTGCACGCT
ATTGGGGTCATGGGGAACTCTTTACTCTGTGAAGAGCCTGAAAAATGGGCTGAAAAACTCAAAAAGCTGA
GAAACATAAATTGGCTAAAAACCAACCCTGAATGGATAAAGCGTAGTATGAATCTAGGGAAAGTCAGTAA
ATCTACCCTCAACATTCAACTCACAGCAAACTACTTGAAAATAAGTCTTGCGTTACCGTTAACCCCCGAA
GAAAAAGCTCTAGAGAAGCAGTTATCATGA