Summary Sequence Context  
1 homologue found:

HomologuedndB
OrganismVibrio cholerae MZO-2
GID1022
PID2022
Locus tagA5A_0794
Locations62385..63464
Length1080 bp
G+C%41
Link NCBI: gi:120616157  
SequenceATGCACAATCAAGATTCCGGCTATTGCTACTCATTCCCTGCGGTTAGAGGTATTCAAGCCGGGCGACCAT
TTTACATCGCGACTTGTCCTCTACGGATTATCCCCAAAATTTTTAGTTACAACGAAGATGATGTTCCACC
CGAATTACGAGCACAAAGAACATTAAATAAGACCCGTATTCCAGAAATGGTGAGGTACTTACTTGATAAT
CCAAAGGATTATGTCTTTTCAGCGTTAACCGCATCAGTAGGAATTGATATCTGTTTCGAAGACCACGATG
GAGCTCCAAATCTAGGAATCCTAAAAATTCCCATGGACGCTCAAATATTGATCAACGATGGTCAACATAG
ACGTAAAGCTATCGAAGAAGCGCTACGAGAAAATCCAGACTTAGGGCAAGACAACATTCCAGTGCTATTT
TTTGTCGATGAAGGCTTAAAACGTAGCCAGCAAATGTTTGCGGATCTCAATAAATACGCAGTAAAACCTA
GCCCTTCTTTAGGGGTTTTATACGACCTTAGAGATGAAAGCTCGGAGCTCGCGAGAAGATTGGCTACTCA
CTGTATGCCTTTTATCGGCTTAACTGAGATGGAAAAATCGAATATCAGCCCTAAATCGAACAAACTTTTT
ACTTTGAGTAGTATCAAACAAGCCACAAGAGCTCTTCTTGGAAAAGGGGCAAAAGATGGTTTTACAAAAG
AAGAAAAAGCATTAGCTGAATCATTTTGGAAAATCGTCGCAGAAAACATGCCTGACTGGCAAATGGTTAT
ATCTAAACAAGTTTCTCCTGCGCAACTTAGACAAGAATATATTCACGCGCACGGGGTCGGCTTGCACGCT
ATTGGGGTCATGGGGAACTCTTTACTCTGTGAAGAGCCTGAAAAATGGGCTGAAAAACTCAAAAAGCTGA
GAAACATAAATTGGCTAAAAACCAACCCTGAATGGATAAAGCGTAGTATGAATCTAGGGAAAGTCAGTAA
ATCTACCCTCAACATTCAACTCACAGCAAACTACTTGAAAATAAGTCTTGCGTTACCGTTAACCCCCGAA
GAAAAAGCTCTAGAGAAGCAGTTATCATGA