Summary Sequence Context  
1 homologue found:

HomologuedndD
OrganismVibrio cholerae MZO-2
GID1058
PID2058
Locus tagA5A_0792
Locations65101..67110
Length2010 bp
G+C%43
Link NCBI: gi:120616157  
SequenceATGATACACGAGCTAAAATTGGCGGAAGATCTTGCCGAATACGAAGATTTCATTAATCACGAAGACTTCG
CAAATAACAAACTGAGTCACTACATCGCTGATGTTCAACGGGTTTACTGCGCAGATAAACGCCCATGGGT
CATTGGATACAGTGGTGGTAAAGACTCGTCTGCCGTAATGTCATTGGTTTACATGGCATTACTCGGATTA
GAGCCAAAAGATCGAAGCAAACCTGTTTTTGTTGTCTCCTCGGATACTCTGGTAGAAACCCCTGTAGTGG
TAAACCATATCAAAGACTCATTAAATGCCATTGAAAAAGGTGCCAAACGCGATCTACTACCCATTACCTG
CCACAAAGTGGTACCCGAAAACAACCAAACTTTTTGGGCAAACTTACTAGGTAAGGGCTATCCAGCACCA
ACAAGGTCTTTCCGTTGGTGCACTGAGCGTATGAAAATTGATCCGGTCAGCGACTTTATTAAATCCAAAG
TATCCCAATACGATGAAGTGATCGTTGTATTAGGCTCTCGCAGTCAAGAAAGTGCATCACGTGCACAGGT
CATTGCAAAACATAAGATTGACGGCTCACGTCTCGCGCGCCACACAACATTATCAAATGCTTTTATCTAT
ACGCCGATTGACACATGGGGAGTTGATGATGTTTGGAAAATACTACGCCTTTGCCACCTAGAAACGAAAG
AAACCCCTTACGGTACTAAAAATATCTGGATCGATAAGTATGACCTAGAGTGGGAAAATCCATGGGGAGG
AAAAAACCTAGTCCTCTGGAATTTATATAAAGACTCTTCTGGTCAGGGCGAATGTCCTATGGTCATTGAT
GAGACAACTCCATCTTGCGGTAACTCTCGCTTTGGTTGCTGGACTTGTACCGTCGTAACCAAAGATCGTG
CTATGGAAAGCCTTATCCAAAATGGCGAAGAGTGGATGTCACCACTACTTGAATTTCGCAACAAGTTGTC
CATGACAACAGAACCGGCAAACAAAGAAGAATTTAGAAACTACAAGCGCCGCACTGGAAAAGTGAGCTAT
CAATACGCCAAAGAGGGAGAAGATATTGCTTCTGAGCGCAAGCATGTCCCCGGCCCCTATTGGATGAAAT
ACCGGCAACAATGGCTGAAAGAGCTACTTGAATTAGACAAAAAATTCAAAAGTGAAGGCCGAGAAATTGA
GTTAATTACCGCCCCTGAATTGCATGCAATTCGTCAAGAGTGGATTCACGATCCAAATGAACCAGATTGG
GATGATTCTCTCCCCATGATATTTAGAGAAGTCTACGGTTACGATCTGGATTGGGTTTATGACGATAACG
CGAGCTTCGGAAAAGGTGACGCCCAACTGATCAGTGAGCTATGTCAGGATTTCGATGTCGAACCAGAAAT
GATCATGAAACTTATTGAGCTTGAAGTTTCTACTGAAGGTTTGAGTAGACGGAATGGCATCTCCAATAAA
ATCGCCTCATTACTAAAACAAGATTGGGGAAGTTTAGAAGAGATCAAACAAAAGCATGCATCGCTACAAA
GCAAAGCTGAATTTGATGTTCATCAGCAAGAGATTGAGCGTTACAACCAGCAGCTTGCCGATCTCGATAA
ACAGCTTCAAAAAGAGTTTTAA