Summary Sequence Context  
1 homologue found:

HomologuedndE
OrganismVibrio cholerae MZO-2
GID1074
PID2074
Locus tagA5A_0791
Locations67110..67457
Length348 bp
G+C%41
Link NCBI: gi:120616157  
SequenceATGCACAATCAAGATTCCGGCTATTGCTACTCATTCCCTGCGGTTAGAGGTATTCAAGCCGGGCGACCAT
TTTACATCGCGACTTGTCCTCTACGGATTATCCCCAAAATTTTTAGTTACAACGAAGATGATGTTCCACC
CGAATTACGAGCACAAAGAACATTAAATAAGACCCGTATTCCAGAAATGGTGAGGTACTTACTTGATAAT
CCAAAGGATTATGTCTTTTCAGCGTTAACCGCATCAGTAGGAATTGATATCTGTTTCGAAGACCACGATG
GAGCTCCAAATCTAGGAATCCTAAAAATTCCCATGGACGCTCAAATATTGATCAACGATGGTCAACATAG
ACGTAAAGCTATCGAAGAAGCGCTACGAGAAAATCCAGACTTAGGGCAAGACAACATTCCAGTGCTATTT
TTTGTCGATGAAGGCTTAAAACGTAGCCAGCAAATGTTTGCGGATCTCAATAAATACGCAGTAAAACCTA
GCCCTTCTTTAGGGGTTTTATACGACCTTAGAGATGAAAGCTCGGAGCTCGCGAGAAGATTGGCTACTCA
CTGTATGCCTTTTATCGGCTTAACTGAGATGGAAAAATCGAATATCAGCCCTAAATCGAACAAACTTTTT
ACTTTGAGTAGTATCAAACAAGCCACAAGAGCTCTTCTTGGAAAAGGGGCAAAAGATGGTTTTACAAAAG
AAGAAAAAGCATTAGCTGAATCATTTTGGAAAATCGTCGCAGAAAACATGCCTGACTGGCAAATGGTTAT
ATCTAAACAAGTTTCTCCTGCGCAACTTAGACAAGAATATATTCACGCGCACGGGGTCGGCTTGCACGCT
ATTGGGGTCATGGGGAACTCTTTACTCTGTGAAGAGCCTGAAAAATGGGCTGAAAAACTCAAAAAGCTGA
GAAACATAAATTGGCTAAAAACCAACCCTGAATGGATAAAGCGTAGTATGAATCTAGGGAAAGTCAGTAA
ATCTACCCTCAACATTCAACTCACAGCAAACTACTTGAAAATAAGTCTTGCGTTACCGTTAACCCCCGAA
GAAAAAGCTCTAGAGAAGCAGTTATCATGA